CR00421

CRIMIC CR00421

Gene CG32751

CG32751

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p1 OK OK78907

Images

Construct Sequences

sgRNA sequence
GTCGAGTGATTGCTAATTGATGG

Amplicon 5' Amplicon 3'
CCCTCATAGATGCCCACTCGATAGCTGTAGTGACTGGTGTTCCTCGAGGGTTTCCCCAAGGATCTCCAGGCCAGATCGAAGTGACAACAGAAGCCACCGTGACACAGATTCTGGCTAAGATTACCGATCTTTCCAGCGTCGATTTTCAGCTCCTCGCTGGTGAAGTTTTCCAGATAATCCCGTTTGATGTTGAAACTTGAACTGGTGGCCACTTGACGTTTGAGATCTCGCTTCATCCGCCTTTTGGCCCTGTATTTGGGTACCCGGGCCACATATATACTTCTCTCACCGGACTCCTGCCGCATCACACTTCTTAGTGAGCCACTGCGTCCGTGATAAATGCCCGATCCACTATTTCCAACAATGGGATCACTTGCTCCAGCAGCCAGCAAATTCACATTGTTGGCATAGGACCAACCCAGCTGAATTTGAACAGCTTTCGAAGAGAAAATACCATTAACTATTAAGTACAAATTATCACCATTGAATTGGCCACAGGTTTAAATTTTCCAAGAGCAGATTGCAAGCATTAACCACTTGAACATTCCGAATGGAGGACACTTTATCTCAAGGGTTTCGTGAGAGCCAT AGTTAACGGGCCCATGTCAGTGAACTGACCCACATTTTTGATTCCTTTCTCGACTTACCTGTGAGGAAGGGCAGTTGGGAGAACCACATGGCCGGATACACGAAGTCCGTAATACCCTGCTCCACGATGAGTTGATGGGCGGGAGTATAGAACAGGATGTCGAAACAGATAAAATGACCGAAGGTGACCCCAAAGTCTGTCTCGAAGGTGCTCAGTTCCGGCAGAAAAGTGCTGTTCTTGGGCTCACCATAGAGATGAACCTTTCGGTACCTGGACACCACCACTCCCTGACGATCGAACACTACATTGGTGTTGAAAACATTCAGTCCGTTAGATGCACATGGCCTCGTATCCTCGGGAATATCCTCGCACTTCTGCTTCTCGGTCAGATTGATCACAATGTATTTACTGGCATTGCGGGCCGCACACGACAGGGTCACCAGAAACTCCTCATAGTAGGTGGCATTGGGATCACTCAAACAGGGGTTTATCTGATCCTCGGGATTGGGCACAAAGGTCGTGGAACCCGCGGAGTTCAGTGTGCTCTCGGGGAACACAATGATGTCCGTAGAAGTGGCATTCTGCGACTGGATTATCTCCAAATAGCCAGCTAGATTGTCGGACAATTCATTGGATGGCTCAAACTCCACC


Search Again