CR00420

CRIMIC CR00420

Gene Rtnl1

CG33113

Information

Donor Location Cytology FBti Stock number
pM37-p12L:4995263..499529125B10FBti0200554Order from Bellen Lab

PCR Verification

PCR check relative to sgRNA sequence

HA-L HA-R Forward Reverse
short band short band ATTTATGGAGCGGAGCAGTGATTGCTGC CCTTCAGCATTAGGCGCGAGTTTAATGAC

Images

Construct Design Sequences

sgRNA sequence GCTAACGATAATTACCACCTCGG
 
Amplicon PCR 5' Left Amplicon PCR 5' Right Amplicon PCR 3' Left Amplicon PCR 3' Right
GTCCTTCTCAGACTCGGCAG GATGGTGCCACAGTTCTCG TTGTTCAACGGCATGCAACT CCAAGCTAAGGGCCTCAGAC
 
Amplicon 5' Amplicon 3'
GTCCTTCTCAGACTCGGCAGCGGCCTCGGGCTTCTTGTTGCCAATGGGGATGGCCACTCGGATCCTGGAACACAAAAGCGATTTAGAATATCTTTCTTACGGAGATTTTAAATGGTTAAACTCACTTGTCGGTGATTTCTGTCAATTTGCTGCGCACCAGATCCAAGTGAGTGTCGATCGATTGCTTGTTGTTCTCGTAGACCTTGGGCAAGGTAAACAGCGAGACAAAGGCTGCACAAATATAGAAGATAATCAGTTCTGTTTTCGATTGGTTTAAGTTAATCCTCCACTTACCCAAGATGACCAGAGTCATGCCATTGAACCAGGCACCCACGTAGGTGAAGACCCACAGAATGACGCCGAACTTGATCGAATCGATGATATCCTCAACAAGAAACAGACGCCTCAGCTCGGAGATGAAGCCATTGATATGTGCCACAGCCACGCCGGCAATGTTCTGTACCTTTTCGTGCGACAGCGTCAGATCCAGCTCCAGGTAATCCCTGATTTCGTAAGGAGTTACGTTAGTTAAACTTTTTTTTTTGTTGGGAGACATCAGTCTACAATACTCACTTAAAGGGGTGACCCTCGTTTGTCTTTTGCACGGCCTGTGTCACAGATTTGTAGATTCTGAAGGCGACGGTGCCGAAGAGGGTTAGGAGCGACAAGTAGGCGAACACGCTGATCACCGAGAAGCTGGAGATGGCCGCCAGTGTGATCAGGCCAGCGCCGAAGACAATGCCGGATTTCTTCACATCGCGCCAGTAGATAAGGGATTCCACTGGAAAGAAGAGCAAATGGATCAATTAGAATCTGCTTTTGTCCACCATACACATTTGATTTTTCATTCCCAAATTATAACCCTCATAAACTGTGAAAAGAGACGAGATACGAGTGGAAAATGTGGACTGAGAATCCCCAAATATACGAAGCACACATACGTTCAGCGTCTCGCACGCATCTATGTACATATATCTTTTCAGCTGGCGGCAATTATGCAATCTATGAGATAAATAGATGAGATACAGATTCGAGAACTGTGGCACCATC TTGTTCAACGGCATGCAACTAAGCTCTGATACTATAATATCTGAACCCAAGCACCCCCTTTTCTCAGCCCGGTTGGTTCACTCACACAATCTGTTCGACATTTTTCGGGTATTCAAGTTTTCGGGTTTTCCAACGGATCGTTCGCGGTGCTCCTACGTTTGACGTTCGCTGCCAAGTTCTACACACTAGAGAAGTATTATTTGGCGTCTGCTGGTCGGGGGCAGAACGTATATGAAAATGTCTAGAAGAAGAGGGCCAAATTGTCCGGACCCAGCCGGAAAACAAAAGAGAGCCGTAAAGAGCATAGCTACCAAGTGGAAAGAGCGATGGCAAAAGAGTGTTTGAGTGGCGAACGGATATGGAAATGGCAGTCGCAAACGCTTATAAATCGATTGTCCAGCTCGTGCCGGAATGTATCTCTTGGATTCGGATTCAGTCGCTGACGTAAACACCTCTCCATCTGCTATAACTTGGCCATCGGATCGGGCTTCATTCGCTTTCGTCGGATTTGCCGATAAGAAGTCACTGCCCCGCGGCGTCTGGGTTAACCCAATTAAGATATGTACTAAAACAAACAAATCGTCTATAAATACACATCTCAAGTGTTGGAAATAGGGGATTTGCCAACTCATTAAGTGGTCATTAGTTTGAACTGATTTGTTAGGTTGCTCAGGTAGCAAGCTACTTAGGGCAATCCAGTAAGGTGCTACCCGCAAGGAAATGATATATGACCAATAATTAACGACAAGCATTTATTATTTTATAGTACCATTGGGTTTGGCCAACACATTAATATGCTTATGATAGTATGCTTGCTTGGAGATTAATTGAAATCTATATATTAATCCTCAATAAAAATGGTATATAAATAGTATAAATGGTATATCACTTTAGAATACACCTAAACAAATAGCATATAGATAGATATACGAAAAGTCTGCAAGCTGGGTAAACTAGTTTCAGATTCGAATTCGTCTAAGTTGCCAGGCCAGACTCGATCTGAGGGGTATATTATGTAAATATGGGTGAAATAAATTAGAAAGGAGACGCACAATAGTGATGAGATGGCAGCGTCTGAGGCCCTTAGCTTGG
 

Search Again