CR00419

CRIMIC CR00419

Gene lz

CG1689

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p1 OK OK78906

Images

Construct Sequences

sgRNA sequence
AAGGGGGCCAGTGAAATGAGGGG

Amplicon 5' Amplicon 3'
ACAAGTAGGACTCGCTCCCAATGTCTGGTCACAAGCCCAGCCACCCACCTGGAGGTGAAACCCTCACTCATCCGGAGCGAAAAGATAGAAATGGACTTTATCGATGGGGTTTGGGGTCTCCGGTTCGAAGTTCTGGGTTTGGGGTGATGCGACTGAGGTTTCTGCGGTCAGATTGGATGGGTCTCTGTCTCCTTCGGGCTTTTGGATCCCGTCCTGGTCCTGCAACAACAATGTCGCTTTGTTGGTGTTTTATTATATGTATGTACATACATACATATATGTCGATGTATTTGCATTGCCAGTTTTACTGACCAGACAGACAGACCGGACCGATGGACAGACGGAATGCTAAAATATCGAAGTAAAAAACCGAAATTCATTTCACATTTTCCCAATCGATAAAAGCTGCCGATGGCTCGCAGTTGCAGTTTGCAGCCGCTTCAAACGGTGTCTAGTTTAATGGCCATAAATAGTGTAAACATTCGGTCAAGCCCAGAAGAAAAAAAAAAACAAAAAAAAGGTTGGTATAACTCTTTTTGGCCACAATGTTGCCCGTTCCTCGGTATGCAAATGTGGAAAGGGGGCCAGTGAAAT CGAGCGAAAGACAGGTTGCAACATTTCCATATTTTATGTGCACTTTAAAGACTTTGGCGGTAGTCATTAAGGCGGGATAAACCAAATTTATGTCAGTGGTTCGAACAAACTGCACCGCCGTGGCAGTTTTGGGGCTTTCAAGGGTTAATCGAACTGCGCGATGCCCTAAATGCTATTTTATGTTCATTCGAGCATTTAAGATCGCAAACTAACACTTTTCACCCAATTTAGTTTGGCAAATAAACTAATTTCCCTTGCCATATCTTAACCGTATCGATTGGTACCCTATATATGAAACATCTATATGCATCGTATCGACCACATACCAAAATTCATAATAATAACTCAAGGGGTTACCGAGTTCACTCCAGACCACAAGCGCTCACACTTTCGCCCAAAAACCCAAAAGAAGTGCAGCCATTAAAGTTGAACGCGGTGACGCGTGTTGCACGGACTGGACTGGGCTTTTGGTAATTTTGGAATCGCAAATTGATTCGGTAGCCCAGTGAGGTCGTCGCATAAATCCTTGCCAGACATTTACGACTAAATTCTCGAATTTGCACCGCTCTCTAATGACGTGCCGCTTCTGATGCTTTCTTATTTTGTTTTTTTTTTTTTGCAGGGAAGAGCTTCACGCTGACCATCACGGTGGCCACGAGTCCGCCACAGGTGGCAACCTACGCCAAAGCCATCAAGGTGACCGTCGATGGACCCCGCGAGCCCCGCTCCAAGACAAGTAAGTGTTGCAGATCGTATAATCCTGAAAAATATGGTCTTAGAATTAGCCATTAACTATGTGAGATGTGCTTGCGATTTCCTGTTGTTTGGCATCGAATGGAATGCCGTGTAGGATAGTAGTAGTTTTTTTCTTTCTGTGCAGCAGCAGCAGCAGCACCCTTCTCAAAGGTGTAAAATATTACAAGCAGTCATATGTAAGTGGCTGCATTGTTTTGCCAATTAGCAATTATCGCTTGCCACAACAACAAAAGGAAAAGCGGGGAAAAACTGATGGAAAGCCGTCCCGCTGCGTTTTGGGTTACCGATTGCAACATGTGGCCATGTCCGCTCTTCCCGCCTGACATCGTAACCGTA


Search Again