CR00415

CRIMIC CR00415

Gene Nep1

CG5905

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p1 OK OK79257

Images

Construct Sequences

sgRNA sequence
ACCAAGGAGGAGCCATTTCCCGG

Amplicon 5' Amplicon 3'
TGCTTGGCATGCCGTTAGATACACGGACACAGAAATGTATAGCTACATAGATAGTTCGTTGGATAGATAGTTGGTTGGTTGGAGGGATTGGCATATAGATACACCTGTCCAGTTGCAGGGCATATCCTGAAATATACATGGGCACAATTACCAGGCGATGCCATCGATTCGAGTGCTCCACTTAGCATACTTTTCGGGGGTTCACCCTAATTGGTAACCCAAATCAGTTGCTTAATTGAACTAAGCAAAAAAGGGGTTTGGCTATTTGTCATATTCTCTAGATAATAACACCTTCGAGGAATCGAGTAATGAAATGACAGATTGTTGGCCTTCAAGTTATTGAATTAGGGAAATTGCTTAAGTGGATGACAAATGAGTGTTAAGTCCGACAGGTAACTTCAAATTTCCAGAATGCAATTTTTGCTGGCAAGCTAGTATCCTTTGGCTTTGTAGCTACAGCATAAATCAAGGACGTTTCTAGAAGTAAGAAAAATCTTGAAGGTGGGGGTGGGGGGGGGGGGCACACTAATGAGTTTCGCACTTAGTTTTCCGAGATAATGAAATTCAGCTTAATGACGTTGATTTATGGATTGGCAGCACGACCAGTGAACAATGC GGCTCCTCCTTGGTAGTTCAGTTCCGCATTCATTCATAACTTTTGTGTGACCGAAAAGTTGCATCGGGGAAAAAAGTGTGTGAATTTTGCGGTGGTGAAAACTACTTTGCTTATCGCTTATCGCAAAAGTTCCGGTGATGATTTGTGGTCCAAGTTTATGGCCGGTGCGATCAAAAGTAGGCATAAATTATGACCTCAACGGGTTGAAGCACTAATTGCACTCCAGCTGAAGAGTTTCCCACCGGGTTGCGTTTGATTTACTGCACTGAATACAGTATTCAGTTTAACACACAAAAAAACCGGGTTTAACACACCAAAAATTATCTAAATCCAGCCGCCTCCCTGCTCTCGGCCATGGACCTCAACTCCGATCCCTGCGAGGACTTTTTCCAGTACGCGTGCGGCACGTGGAACAAGATGCATCCCATTCCCGAGGACCGCAGCTCCATCAGCACGTTTGAGGTATTTATTTCGAGATTGGGATATGCCTCCGTAAGATTCGGTTTTCTAAGTGCTTATCCTAATTTCACGCAGGTCCTGTCCGATCAGCAGCAGGTTATCCTGCGCGCAGTTCTGGAGGAACCCATCGATGAACGCGACAAC


Search Again