CR00413

CRIMIC CR00413

Gene prom

CG42310

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p1 OK OK78905

Images

Construct Sequences

sgRNA sequence
TAGGCATTAAAAATGCATGTTGG

Amplicon 5' Amplicon 3'
TGGGTGAGATTGAAGCGTCCTGCCACACGACTCCCATCCGCCATCCTCAACTGCACGGTGGTCGTGTCGGCCCGTTCGTTGAGCTGAAGGCCTTGGGCTTCAACGGGCATTGGGCCTACGACGAGTATCTGGGGCGAGGGGCTGTTCAGCGGTCGACCTGGTCCCATGAACTGTTTCCGGGACAAGTGACGATAGGATTCGTTAGTGTGATCCTGCACGCTCAGCTGGACTCTGGGCACCCGGAGCATTTCCTCGGGGAAATCCCCCCTCAAAATAGCGCGGAGAAATCGCTCGTTTTCGGGCAGTGCATATAATCTCAACGAGCCGTCGTCCAGGGAGAATCCCTCAGACCAGAGGTGAAGGACGACTATGGTGTGCTCGTCGTCGGCCGGCTCCGTATCCGAATCCTCGGTCGCGGATCGAGGAGGCGGATTGATGGGATGGGCGCTTCCCAACCGATTGCCATGACCCCAGACCCGCAGACTGCGGTCGCTGTCGTTGTTGGTTATAGCCGGCGTGGAGCTGTTGATGTTCACCCGCTTGCCCGCCGGAGTGTCATGATCGGTGGAGCTGTCCGATGCACATGCCTGGTAGCCATCGTGGTCGCCCTCCTTCCGCCGGGATATCTCACTCAGCAGGGAATGGAGATCCCGATTGCTCTCATTCGCTTGCGAGTGCTCGGAGGACTTCTCGGGCTCTTGCTTTTTGGAAACCGCCTCCGATTCGTAGGTGCTGCTGGCTACCTCCAGGGACCAGTTGTTGGAGCTCAGATACTGACGGGCCACCTCCTCACGCACCCCATGCCGTTTCATGAAGGTGCTCAGCTTCTGCTCATCGGTCATCTGGGCAGGGACGAACAACCCTGGGGCTGTTTCGTCGGATTGAATTTAGAAACACATATCGTCCGAAGGGGGATCACTGTAGCTAGGCCGACTGGGGCTTTGGCTCGTTCCGAAAGTCCTTGTGGCAGCCACAGACTCTCGCC GGTCAGGGACGAGGCTAAGACTACTAAGGGATTAGTGCCATTGAAACTATTTAATTCAAGCTTGTTTTAAACGTAATACCAAGCCCTGTAGCACTTCGAAAAAATATTTTGTATAGAAAACTATCAGAAAGAATTTTATTAAAGGTCCTTTGCTAAAATAAAATATTAAAGTAGTTTTGGGCGAATGTAATAGCTATCATAAGGACACCACTAATAAAACATTTAAAGAAAATCCGAATACGAATCGACATAATTTATGCGGACACAAGTTTTTCCCTGTGCACAATTTATATGAGGTCTTCCATCTGGGTTGAATAACTTGCCCACCTATCAAAGGCTCTCCTGAATTTACATCTCTAATGCCTTCATTGTTGGCAAGCAGACGTTCTGAATACCAGCCCACACACCTGGAAACCCTTTCCCCGATATCATTCGATCCTACACGGGCACAAGGATGCAGGACCACGCCCTCTGCGAGGGGCGGACATGGAGGGACTTACCCAGCGGCAATTCCTCGGGCGTGATAAGCGATAAAAATTCACTAACGTAGGTGAATATAAATGGTCCTGGCGCAATGTCCATGCCTGGTATGCTGTAGGTAAAAAATGTGGCTGGCGTCGTTGTTGGCGGCGCCGTTGTTGTTGTTGTGGCTAATGCTATTGTGGATCCGGTCAGGGCGGACGTGGTGGGTCCTCCAAGGGATGCGAAGCCCGCCGACATCGCTGCTGATGACGAGGACATAATTGTTGTTGCGGCTGGCGTTGGCAGTGTTAGATTGCGCTGGTCCATCTTCGGCCGGATGGCTTGGTTCTCCGCCCTGCGAATGAATTAATGCGGAACAGGCATGGCCATGAATAGTCGGGTAGAGCGCGGGAGCGCGGAGAGGCGGAGGGGCAGAATGGAGCTGAGCCGTATCG


Search Again