CR00412

CRIMIC CR00412

Gene Gyf

CG11148

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p1 no band short band79256

Images

Construct Sequences

sgRNA sequence
TAGACCAGCTGAAATCCCTATGG

Amplicon 5' Amplicon 3'
AGGATCTTCATCACGCCAGCTTGTAGATCTTCCTAAAAAAAATTTTTTTTTAAGTTCTATACTGTTGTTCAATAACTTGGACTATTTAAATTTTAACTTGGTTCATCTTCTTAGCAAATATAGCAAACTTACTAAACAGAAAACCGCTATAGTCGAGCTATTGCAAAACTGTTACCCATTTAGTTAGATACTAGAAATGCAAGCGATATTCAGATATACAAGTAGGAAAGCAAATATGTCAGTGATTGTACACCTGATCCACATAGCGGCAGAACACTAACTCTTAATCACTAAGCACGACAAAAATTTTATAAATACATTATATATACAATTTATTATAGTATCCAAACTTCGATAGAAGATTACCGGGTGAAGAAGTACATTTTAATAAAGCGTAAAGCGTATCAAAGTGTAAAAAGTATATTTGGTTACGTTGTTATGTATAGGCAAGCCCATATTTGAATAGTTTGAACTGTTAGTTAGTTGGACTTTGATACATAACACTTAAAATGGGCTCGCGTTTTTTTATTTTTCAATTTTGATAAATCAAGTCTATTCTGGAAAAAAAAAGATCATTATTTGAAAACGTACTAAAGCTACCAGCGATGTACTTTAGGAATGAAATAAAAACAAGGCCTGATGCATTG GGATTTCAGCTGGTCTATTAGCATTTTTGTTTAAATATTCTCATATAAAATACTTCATTAACTAAAACATTTAATCTTAATTTTAATATATTTATGAAAAGGTTTTTTAGAATACGTTTTAAAGAAACACAAACTTTACAACAGATTGTAGCATGAATGGTATCGAATGAATAGCCAACTATATAGGCTGGGGAAAGTTTTGGAAAGTCAAATTTACATGATAGAGATAGCAGTACATGTATTATTGTGCTCATATGTGTAGGAGTAAAAATGAAAAATAATAATATAAAGGTAATTGACTGACCCCACCGATGGCTATTGGTACCAAAACCTGCGTTTGTACTTCCACCGACGACACCGCTCCGCCAACCAGCAATATCGGGTCCGCTCATGGAACCGCTGGAGGATGGACCATCACCGGATCCATCTTCGTTACGTGTTCGTCGCCAGTTTTCCAAGTTGCGATGATTATTAGAATAATCTTTTCGAGGACTTGAGCTTGGAGTTCCATTCCAATCTAGAGCACCAGAGCCACTAGTGGAGGTGGTGGTTGCCGCAGAATCTCCAGTTCCGTTGCGGTCGCTCCATGTGCGTTCGGCCTGGCAGAAAAAATCAACAACTAATCGTACTTCCTTATTTAGTTCGTATTTGCAATTACCTTTGATATAACCGATAAGCTTTCATCATATAGACCGCTTGGGCGTTGGTATATCGGATGATAGGCCGATTTTCCGCGCATCCGTCCCCGGTCAACGGTTCCACCACGTCCAGAGCCTCGGGAGGCACTACCAAATCCACTGGGCGAGCGCTGCAACCAGGCAGGACGAGACTAGTTTCAAAGAAAAGTAAATTATGTTCTAAAACTCATGTCAAATTACTTCACATACGTTATTGCCAAGTGAGTTTTGGTTGATGTCCTCCTCGGAGCTCGGTGTCAGTGCAAGAGGGCACTGAACCTTTTCCACGAAGAGCTTTTTGAACGATGGCAGGATCTGCGGCAGTAGGCAGTTCCGATCGAACAAGGACAGCATTTCCTCGCGTCCGTACCGGTATTCTGGAAATAGATTACGGGAAGCGGATGCCGCCGTGTTGTTTCCCAGGTTGTGCCCTCCAATCGAATTGTTTTGAGCTGCATTACCAACGTTGTAGGTACTGGGAGAGCCCGAAGGCTCGGCTGACATAT


Search Again