CR00409

CRIMIC CR00409

Gene Mtpbeta

CG4581

Information

Donor Location Cytology FBti Stock number
pM37-p12R:23868373..2386837360A5FBti020055283173

PCR Verification

PCR check relative to sgRNA sequence

HA-L HA-R Forward Reverse
no band OK GCGGAGCTTTGGACATTTCCCGACAAAA GACCTTCTCGTTCAGGCCCAAGTAAGT

Images

Construct Design Sequences

sgRNA sequence TGATAATTCATAACGATTTGTGG
 
Amplicon PCR 5' Left Amplicon PCR 5' Right Amplicon PCR 3' Left Amplicon PCR 3' Right
CCAGATCGGTGAAGTAGCCC CAGCAGCAGCCGATTGAA TGCTGCCACAAATCGTTATGA GAGCGCAGATGGACATCGTA
 
Amplicon 5' Amplicon 3'
CCAGATCGGTGAAGTAGCCCTTCTCCTGGGCCTCCTTGGCCAGTGTGTGGGATCGCAGGGCGTACTCGTCCTGCTCGCTCCGGGATACGTTGAAGGCGGATGCCAAGCGATCGGCCGAGTGTCCCATGGTCTCGCCGGAGGAGAACTCCGCAACGGCGGGCAGCTCGGGGGCCAGGAAGTCTGGCCTGAAGGTGGACAGCAGGGCCAGCCGCTGGCCCAGGGTCTTTGCCTTGTTGGCTTTCAGGAGCAGGGAGCGCATCTTGCGGGAGTGGCGAATGGGCACATCGGACATGAACTCCACGCCGCCGGCAACGATGACATCGTAGGTGTTGGTGGCTATCAGACCCATGCCCGTGGTGATGGCCTGTAATACATGGGCTATAGATTCAAGCTCCGAGGAACTTTGGGCGAGGCTCTTACCGCATTGGAACTGATGCAGGCCATGGTGACGGTGTGGGCAGGTGTCTTGTTGCTGAATCCAGCTGCCAAGGCTGCCTCCCTGGCAATGTTGGAGGTCTTCACCTCCTGGATGACGCTGCCGTACACGATGTAGTCGATGAGCTCCTTGTCCAGGCGGTTCTTTTGCAGCAATGACCTGTTGAATGGGGCGGGGTAAGCTAATACTCCAAGGATATTGGGGATTGTAAACCTACAAAAGCGAGTGCCTGGCCAGTTCATGGGGCATCAGCTTGGAGTAGGTGGTTCCGGAGGTCAGAAAGGGTGTGCGGACTCCATCCACGAGCACGATATTCTGGCTGTTCTTCTGCTTCGGTTGTGGATTCGCCACAGCGGCCGATAGAGCGCGGCATTGAACTGAAAAAGGGTTCCGGATTCGGGATTATCCTTAGCACTCTCGTTTCGCGTTATTTTTAATCATGATGTACCCATACATTATCTTTGTCCCGCAAGACGTCACTGCGAATTCGAGTTTGGACTTTGGCCCTTTCAGATTCAATCGGCTGCTGCTG TGCTGCCACAAATCGTTATGAATTATCAGAGCCAAAGTCCAACTGGTGCAGCCCGTGTTTGGAATGGGGCATACTGCAACACCCGCACTATTAACTCACCTTTCCTGGCGACATTCAACAGGTTGAAGGCGTTACCCTTGCGGCAGACATTTTGAAGGCTCATCTTGCGAAAGTTTTCTGATTTCTTTTCTCGCTTTTCTCGTTGTTGCGACTGCAGCTGTTTGGCTAGTGATGAACATGAACGCCGGATCGCGGCGAACTATCGGTTATCGAAAGCTGATGCATGAAAAGCTTTCGAACTGTAAATACCCTTTCTGAGGATCTTACTCGTAGATCATAAAGCATGACAGCTTGTAAAATTCGGTAGATCTTCATTTCCAACTTTAGATATATTTCTTGGTTATATTTGAATATACAGTTCTAAATTTTTTAGCTTCTGAGAATCGTTTACTATTCCTACACCATTCACCTTCATTCAAATGTATGCAACGCAATCTGGGAGTCCCATAAAGGAATAGATTTCTCCAATGACCTTGATCTTGATTATCCTATTAAGCGTGCTGTTTACGATGTCCATCTGCGCTC
 

Search Again