CR00409

CRIMIC CR00409

Gene Mtpbeta

CG4581

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p1 no band OKOrder from Bellen Lab

Images

Construct Sequences

sgRNA sequence
TGATAATTCATAACGATTTGTGG

Amplicon 5' Amplicon 3'
CCAGATCGGTGAAGTAGCCCTTCTCCTGGGCCTCCTTGGCCAGTGTGTGGGATCGCAGGGCGTACTCGTCCTGCTCGCTCCGGGATACGTTGAAGGCGGATGCCAAGCGATCGGCCGAGTGTCCCATGGTCTCGCCGGAGGAGAACTCCGCAACGGCGGGCAGCTCGGGGGCCAGGAAGTCTGGCCTGAAGGTGGACAGCAGGGCCAGCCGCTGGCCCAGGGTCTTTGCCTTGTTGGCTTTCAGGAGCAGGGAGCGCATCTTGCGGGAGTGGCGAATGGGCACATCGGACATGAACTCCACGCCGCCGGCAACGATGACATCGTAGGTGTTGGTGGCTATCAGACCCATGCCCGTGGTGATGGCCTGTAATACATGGGCTATAGATTCAAGCTCCGAGGAACTTTGGGCGAGGCTCTTACCGCATTGGAACTGATGCAGGCCATGGTGACGGTGTGGGCAGGTGTCTTGTTGCTGAATCCAGCTGCCAAGGCTGCCTCCCTGGCAATGTTGGAGGTCTTCACCTCCTGGATGACGCTGCCGTACACGATGTAGTCGATGAGCTCCTTGTCCAGGCGGTTCTTTTGCAGCAATGACCTGTTGAATGGGGCGGGGTAAGCTAATACTCCAAGGATATTGGGGATTGTAAACCTACAAAAGCGAGTGCCTGGCCAGTTCATGGGGCATCAGCTTGGAGTAGGTGGTTCCGGAGGTCAGAAAGGGTGTGCGGACTCCATCCACGAGCACGATATTCTGGCTGTTCTTCTGCTTCGGTTGTGGATTCGCCACAGCGGCCGATAGAGCGCGGCATTGAACTGAAAAAGGGTTCCGGATTCGGGATTATCCTTAGCACTCTCGTTTCGCGTTATTTTTAATCATGATGTACCCATACATTATCTTTGTCCCGCAAGACGTCACTGCGAATTCGAGTTTGGACTTTGGCCCTTTCAGATTCAATCGGCTGCTGCTG TGCTGCCACAAATCGTTATGAATTATCAGAGCCAAAGTCCAACTGGTGCAGCCCGTGTTTGGAATGGGGCATACTGCAACACCCGCACTATTAACTCACCTTTCCTGGCGACATTCAACAGGTTGAAGGCGTTACCCTTGCGGCAGACATTTTGAAGGCTCATCTTGCGAAAGTTTTCTGATTTCTTTTCTCGCTTTTCTCGTTGTTGCGACTGCAGCTGTTTGGCTAGTGATGAACATGAACGCCGGATCGCGGCGAACTATCGGTTATCGAAAGCTGATGCATGAAAAGCTTTCGAACTGTAAATACCCTTTCTGAGGATCTTACTCGTAGATCATAAAGCATGACAGCTTGTAAAATTCGGTAGATCTTCATTTCCAACTTTAGATATATTTCTTGGTTATATTTGAATATACAGTTCTAAATTTTTTAGCTTCTGAGAATCGTTTACTATTCCTACACCATTCACCTTCATTCAAATGTATGCAACGCAATCTGGGAGTCCCATAAAGGAATAGATTTCTCCAATGACCTTGATCTTGATTATCCTATTAAGCGTGCTGTTTACGATGTCCATCTGCGCTC


Search Again