CR00407

CRIMIC CR00407

Gene Tg

CG7356

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p1 no/short band OK79255

Images

Construct Sequences

sgRNA sequence
ATGAGATCATCGGCTGCCACAGG

Amplicon 5' Amplicon 3'
GAAACGTGCCGAACAAGGTGATCAGATCAGATCAGCCATGTGGAAACAAATGCCCCAATAAATCATAATTGCAAGTAAAATCGATTTATTTTCGATGCTTTACCACTTAAAGAGCTTACTCTAAAAATGCTTTTATTTATTGCTCAAAAAAAAAATCCGTAGATGCTCATGAGGAAGAAATCGAAGAAATCTATTTTTATTTCAAGCAATGCGACCCTCAGTGACCTCAGTAAATTGAATTTCATTCATTAAATACTTTATTCTCCCTTTCAAAAAAGCAAACTGTTACCAAAAAAAAAAAACTAAAAGTCATTTTTATGAAAAGTATTGTTTTCTAATCTGATCTAATTAACCAGTGAGCCCCCATTTTCACTTTCATCCATAACTTTTTAACTTTGCAACTTTTTATTTTGTTACCCTGCGCTGAAAGTATTTTTTCTTTATTTAGTTTTCATATATTATTTAAATTTTCTGTTGGTTCTAGTGGTGCGTTGGTGTCACTTTTATTGTCCACTACGAAAATTAATTGGCTTGGCATTGATCTTTTTGCCATTGTGGCACAAGTTTGTTATGTTTATGGCTAAAGGCGATTAGTCAATTTGATGCTGCAGCTTTGGGGAATA ATGAGATCATCGGCTGCCACAGGGAAAAAATCAACGCAAAAATATCTCTTGAAATTGGGAACTAATTGATGACAGATTTTATTCAGACCCTGCCGAAAATACTTATTACTTGTATTACTCACAAAGATGAAATACTTGGACTAACTCAAGTTTTGATTTCAACCAACAGATGGCGCCAGCTCAGCAGTATTGGGCGTTTTGAAGGTCGATCTGTGCCTGGAGGACAACCATGAGGAGCACCATACGAGTCACTTCTATGCGGCAGCTGCCAAGGAAGCGTTGGTCGTGCGACGAGGAGAACCCTTCCGGCTGAAGATCCACTTCAATCGAGACTACAGTCCCAGCAAGGATGCCATCAGTTTCATTTTCACAGTAGCGGATGACACCAAGCCGAGTCCCGGTCATGGAACACTCAATGCCCTGGTGCCGCACGATGGCATCGATTATCTGGGCGACACTTTGGAATGGGGAGCCGGCATCGAATCGCATGAGGGTCAAACGCTTACGGTGCTAATCAAGCCACCATCCACCTGTCCCGTAACGGAATGGAAACTGGACATCGACACGAAGCTGCTGGGCGATGGATCGCGAAGCTATCCCCTGCCGTTGCCCATCTATGTACTCTTTAATCCCTGGTGTCCGGATGATCAGGTGTATCTGGAGGATCGTGATCAGCGCAAGGAGTACGTGATGCACGATACCACGCTCATCTGGAGGGGATCGTACAACAGATTGCGTCCATCGGTTTGGAAAATCGGGCAATTCGAACGACATGTGCTCGAGTGCAGCCTAAAGGTATTGGGTACGGTGGGCAGGATTCCGCCAGCCTACAGAGGCGATCCCGTGAGAGTTGCTCGCGCCTTGTCCGCACTGGTGAATTCGGTGGATGATGACGGTGTTTTGCTGGGCAACTGGTCAGAGGACTTCTCCGGCGGCGTGGCACCCACCAAGTGGACTGGGTCCGTGGAGATTCTTCAGCAATTCTACAAGACCCAGAAGTCGGTGAAGTTTGCACAGTGCTGGAATTTCAGCGGTGTTCTGACCACCATTGCCAGGAGTCTGGGAATACCGTCTAGGATCATCACTTGCTACTCCTCCGCCCACGATACACAGGCCTCACTCACCGTGGACGTGTTCATCGACGCGAACAACAAGAAGTTGGATGCAGAGACCACGGACTC


Search Again