CR00405

CRIMIC CR00405

Gene CG7766

CG7766

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p1 short band OK79254

Images

Construct Sequences

sgRNA sequence
GAGCGCCGCTTAAATACTACGGG

Amplicon 5' Amplicon 3'
CATGGTGGTGGGACAATCGAGGACAGGCGACGTTCCGTCAGCGGAGAAGGTCCCTCCATGCCCAGGTTATCAGCTGAAATACGCAAAAAAAAAAAACAGCATTAGTATTCAGTACTACGATGTGGTATCAAAAGCAATCAATCACTCACAATCCACGTTGATGGAGCGCGTCTTCTTGATGGCTCCCTTGCAGGACATGCGTCGCCTCAATGTTCGCGGACGCAATTGTCCGCCGCGCAGATTCATGGTGCTGCGATTGCTAAACGAGCGCAGCAGATGCTCATCCAAATAGGTCTGCACATCCGGATGCAGGCGGTCCGGATAGCCATCCTCGGTGCTGCCCAAAAAGCTCAGATCCGTGATGGCCGAGGTGTTGAGAAAGTCCTTCAGGCTGCCCAGCATTACGCGTGTGCCATTGATGTAGCCCGATTTGAGTTTCCTCATCGTCTGGATCATGGCCAGCGGGATCTTGTCCTGATCTGTGAAATTCCGCAGCGCATCCAATACATTTGTGTTAGCTTTTCGGTTTTTCACATTGTGTTCGGTTCATAGCAATGAATATGTGGGTCTCATGATCTGGTTGGGATGCTCG AGGAGCGCCGCTTAAATACTACGGGTTAGTCACACAAAAAAACAACATAGTAACCGATAGATAGAAGCACACGATTCCAGCCACCATTGGCAATTAGTCTGCGTTTCGCATTTTCAGTTAGGTGCACAAGGCAAATGCAGTGCAAATACTTAAGGAAATGTTTTAATCACAGGTTGGGGTTATTTACGCAAAGTAGTAAATAAAGTTATTAGCATTAAAGTAGCACTGTTTTTTTTTGGAATATGTCCGTTTTCGGTCTGTGGCGTAATAGTGTATAGATGATAGCTCAGAAGTCCAGAAATCCCAGGATAGCTTAGGCGTTTTTAGCACAGCAGCCAAAATGGCTATATCTTGTGGAAAATGATTGAAAACTAATGGAAGATTGCAAGCTCTATAATTTGTTTTGATCTAAAGATGATTTTCACAAGATATTGGTGTATATAGAGTGTAGAGGTGTTTAAAGCATAGTATTTACACTGAGAAAAGCGAGCAGAAAGAGCGGAAGCAGTCAGGCCATTTTTTACGAAGCAGACACAAGCGGGGGTCACAGGTCACAGATCAAAGATCACAGATCGTAATATCAATTGTTTGGCTTTTTTTTTGGTGTGTGTGTGCAGGAAGGTACATATATGTATATATATGTAATGCAGTGGATTTCTTGGAATCGAGTGTTTTTTGTTTTGTTTTTTTTTTTTTCCATTTTTGGGTGCAAAGTGGGAATCGGATTTCGATTTGGGATCGGGTAGTTTTTTTTTTTATTTCGGGTAGTTACCTAGCATATAGTGGGTTGCCATTAGTGTGATTGTCGGCCTGCCCAACATGTGACGCCAATTGTTGGTCAAGAATGCTAAATTTGTGGTAAAATTGCTGGCAAGCAAATCGGGATCGCGTGTTGTATAATATTCTTCATAGTCGATATGCTGTGTATTTATGGTTGTTGTTGTTGTTGTTGGTGTTGCAGTTGCAGTTGTTGTTGTTGTGTATATTTATTATATTTATTTTGGGATAAAATAAAGAGAAGAAAGGATGTTTTTTGATTTTGATTTTCATTCTCAATTTTCTTTCAACAATTTCATTGGCCAATTTTCGGAGATTTCGGGGGCATGGGAATGAAAATTATAGGGTAATACAAGTCCAGAGCAGAGCGTTGAT


Search Again