CR00404

CRIMIC CR00404

Gene Taldo

CG2827

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p1 OK OK78904

Images

Construct Sequences

sgRNA sequence
TATAGTACACTTTACTATAGCGG

Amplicon 5' Amplicon 3'
CCGACCCAAAATGTTCAGCGCTTTCTGTACAAGAACGAAAGTATGCACTTATTTATTCGTCCAATTACAAGTAGATGGTTATTTATATTTAACAAGCTATTCACCTAAGATTAGCTTGAATACCTTATCATCACAGTTAAAGATTAATGTTAGGGAGCTAGTTTAAGTCTGCTTAATTGTCAGGAATCCCCCTGATGGCCCCTTATATCGATTCCTAAACCCAAGTTGGGGCTGTTCAGTATTTTTCCAGAGCCGGGCGGTATAAATTGCCGCTCCAGTGGCGGTCTTATTGCATTGAAGTTGGGCAATGGGAAGTGATCGCACGTTAAAAAAGCAAAAGATGTCGGTATTACAGGAACTCAAGAAAATCACCACAATTGTGGCTGACACCGGCGACTTTGAAGGTAAGTACGCACGCAAGGTATTTTTCTTAACAAGATGAGTCCGATTTCAAAGCTAGCGTAAGTTTGCCTCAAAAGTGGGAATCCAGAAATGCAACTAAAGCGAAATGCGAGTCTGAGCTCGAACATCCATACATATATAGAGCATACATAGAATCCGAGTCCAAAGATACATAGGATACATGGATTTATCCAAAAGATAAACATTAACGACGGGCCATCGGATCCGTCGTGTCTGCCGCAGTGAAGATCAAATAAAAGTGAAAAGCAAATCCGAGCTGACTTTAGTTTGACCTTTGGTGCTTACGTGTGT ATGTGACCGCTATAGTAAAGTGTACTATAGAATGCCACCAGAGATAAGGTTTCGGAGCAGAGTGCCAAACCTGCTCAGACATTTGAAAAGTTCAAAGATATTTTCGGTCGGGCGATTGAAAAATGAAAGTCGCTCAACAGGTTTCGAGGTCTTTCTAAAATTCGCAATGTAATTTGGCCCCGCACTTATGCAAATACTTTACACATTGCTTCCAGCCATCAACATCTATAAGCCCACGGATGCCACCACTAATCCCTCCCTCATCTTGTCCGCTTCGTCCATGGAGCGGTACCAGCCGCTGGTCCAAAAGGCGGTGGAATACGCCAAGGGCAAGAAGGGGTAAGCAGTTCACTTGGGTGTTTGCCACACAAAGCTACATAGAATACCATCGTTTGCAGCTCCGTGAGTGAGCAGGTGGCCGAGGCCATGGACTACCTGTGCGTGCTGTTCGGAACGGAAATCCTGAAGGTTGTGCCCGGTCGCGTTTCCACCGAGATCGATGCCCGCTTGTCCTTCGACACCAAGAAGAGCGTGGAGAAGGCCCTGAAGCTGATCGCCCTGTACAAATCCCTGGGCGTCGACAAGGAGCGAATTCTGATCAAGCTGGCGTCCACCTGGGAGGGCATCAAGGCGGCCGAGATCCTGGAGAACGAGCACGGTGTGCACTGCAACCTGACGCTCCTTTTCTCGTTCGCACAGGCCGTGGCTTGCGCCGAGGCCGGCGTGACCCTCATCTCCCCGTTCGTGGGCCGCATCCTGGACTGGTACGTGGCCAACACGGATACCAAGAAGTTCGAGGCGCTCAAGGACCCGGGCGTGATCTCCGTGACGAACATCTACAACTACTACAAGAAGTTCGGCTACAAGACCCTGGTCATGGGCGCCTCCTTCCGTAACGTGGGCGAAATCAAGGCCCTGGCTGGCTGCGATCTGCTTACCATCAGCCCAGCGCTGCTTAAGGAGCTGGAGAACGAGACCGAGTCGGTGGTCACCTACCTGTCCGTAAGCAACGCCAAGCTGCAGGACATCGAGAAGATCACCGTCGATGAGAGCCGGTTCCGCTGGCTGCTCAACGAGGACGCCATGGCCACCGACAAACTTTCCGAGGGCATCAGG


Search Again