CR00398

CRIMIC CR00398

Gene spas

CG5977

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p1 short band OK79252

Images

Construct Sequences

sgRNA sequence
CCTACTCCTGTTGACATTTGGGG

Amplicon 5' Amplicon 3'
TTTCACGGGGTTAGGGCAAGGAGAGCAGGGGGCCGGAGTGCTGGACGCGCAGACAGCGCGGAATCGATATCGATGGTACGCACTAAAAACCAGTCGTCCTCCTCCAGCGCCAGCAGCAGCAGCACCAAGTCACCAATAAAGTCCAGCAGCGGGGCAGGATCATCCGGCGGAGGACTCGGTGGTCGCCAGTCCACTCACCGCTCGTCGAGCGCCTCAAACGTTGCTGCCGTTGTTGCCGGCGGTTCATCTGCCGCCGGTGGAGGCTCCTCATCGAATCGCCGTAGTCCGGGCAGCTCACCCGACGGCGACGACGACACCACCACCACAGATGACCTGACCCCCACAACGTGCTCCCCACGCAGCGGCCACCACCATTCGTACGGCGGCTACTCGTCCTCTGTGCACAAACAGAACCTCTACGTCGTCTCGTTCCCCATAATCTTTCTTTTCAACGTTCTGCGCTCGCTGATTTATCAGCTGTTTTGTATTTTTCGCTACCTATACGGTGCGAGCACAAAGGTGATATACCGCCCGCACCGACGCGACTGTAATATTGAAATCGTGGTGCAGAATTCCTCCAAGGAGCAACAGCAGTCGTTGAACCATCCTTCGGAGCTGAACCGTGAAGGTGACGGACAGGAACAGCAGTTATCCAATCAGCCACAGCGTTTCAGGCCCATTCAACCGTTGGAGATGGCCGCCAATCGTCCGGGAGGAGGGTATTCACCTGGTCCCGGCGATCCATTGCTGGCCAAGCAGAAGCATCACCATCGACGCGCCTTCGAGTACATCTCCAAGGCGCTCAAAATTGATGAGGAGAACGAAGGTGAGTTTCGGCGACGGGGGTGGCAGCTCCAGTTCGAGTTCGAGTGCTCGAATGCTCAATGAGTCATCGCCCGCTGTCCGCTTTTGTTGTCTGTCGAGTGTGAGAATCAATAAGGCAAAACGCGCGCACAATGGATGCCCCAAATGTC AGGGTTGTCTGCCTTGATGGACTTTTATGGAGTGGAAGTTCTCCAAGCATGCGATTTTTAAATTCTAATGCATATAAGCGTACTCTTTGTCAAATTATTTATAAGAGGAAAGCGAGCTTGATTGAACATAATAGTTATAAAATAAACATAAAATAATATTATTCTATATATTCAGGTCACAAAGAGCTGGCAATTGAGCTCTACCGAAAAGGTATCAAGGAGCTAGAGGATGGCATAGCTGTCGATTGCTGGAGTGGACGTGGTGATGTGTGGGATCGGGCTCAGCGCCTGCACGACAAGATGCAGACAAACCTTTCGATGGCGCGGGATCGTCTCCATTTTCTAGGTAAGTGACCAGTCATATTTCCTATACCCCTAAAACATAGGATTTGTTTACCTCATTTTTTTTTTATTTCATTTTGCACGTTTTCCCCTGCTTTTTTGTTGTCCCCTCCGTTTTGTCCATATGCACATGTTCATCCGGTGCGCAGCTCTGCGTGAGCAGGATTTGCAAATGCAGCGCCTCTCCTTAAAGGAGAAGCAGAAAGAAGAGGCTCAAAGCAAGCCGCAGAAGACCAGGGAGCCCATGCTGGCAGGAATGACCAACGAACCAATGAAACTAAGGGTGCGCAGCAGTGGCTATGGGCCCAAGGCCACCACCAGTGCCCAACCCACTGGTAAGTTCCTCACCAGCTAACGCGCACCCAACAAGATCCTCACACGCCAGCGCAAAGCCACCATAAGCAGATCGATTAGTCAATCCCTATCACCTCACTTGGCACTTGATTTTCTTAGAATTTTTTATTTCGATTGGCCAAATTGTAAACTTGTAAAAGAGTATATTCTTCCGCATTATCCATCTCTGATTGTGCTAATTCGTTCACAGCATCTGGCCGCAAACTGACAATTGGATCCAAACGACCCGTCAACTTGGCCGTGGCCAACAAATCACAAACGCTGCCCCGCAACCTTGGCTCCAAAACATCTGTAGGCGCAGTCCAAAGGCAACCAGCCAAGACAGCTGCAACGCCTCCCGCCGTTCGGCGACAATTTGTGAGTATCTGATAAGTAAACTAAATTTGTTTTTACACATTTGGCAAATACTCAGAAATTAAAATACTAATTAAACTAAATTACTCATATTACAGTCTTCGGGGCGTAATACGCCGCCCCAGCGTTCGCGGACTCCCATAAA


Search Again