CR00395

CRIMIC CR00395

Gene unc-119

CG1659

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p1 OK OK78903

Images

Construct Sequences

sgRNA sequence
CTGTGAGATGAGGCTTCTATTGG

Amplicon 5' Amplicon 3'
GAACACAATCCGCGTGCTTCAGTGTGTTGTTGTTGTGTTTGTGTGTTAGTTTCCGTTTGCAGGAGATCATATCTTGATGCTAAATACATCAAACAGGAATGGTGGGTAAAACTTTGGTGTGCTAAGGCTAAAATGGCTGTGATAATATTCCTCGATTCGATTCGATGTGTTTGTGAGTGTGATTGTTGACATTGAGTGGGTGTTTCGTGTGTGTGTGTGTGTGACAAGTCATTGATTTTGTCTCACAGCTTCTGTAGTTTCTAGTTCTTTAGTTATTAGTTTTGCTCTAGTTGCAGTTCCATTATAGTTGAGTTTCTAGACTATATTGCCGCCATCGTAGGCGTAGTCGGCTTTGTTGTGCATGACGAGTCGGTTTCCCACAAAGTAAAAGCTGTCCGAGCGCGTCTCAAAGGGGCTCGATATCATCTCAGCAACTAAAAAAAAATGGAAAACGAACGAACATATTTATGTGAATTGCATTTCATTAATAAGTCCACATCCTACAAACCGATAACAAAAAATAAAAACCATGATAGCTGCTCGCAATCTGACCAATAGAAGCCTCATCTCACA ACAGGCGCAAATCGTAAACGACCTTGACCCACAAACCCCTTCAACTTTTGGCAGCAACTTTCAATTGCGTGTCATGCTGGCTGGGATTATGTAAAAATTGCTCACCTAGGTCGGGTGGAAGGTTAGGAAACTCGTAGATGTGCTCAACCGTATTCTTCGAAAATGGAAAGCAAAAGCCGAACTCAAAGTCAAACGTCTTTAGCAGGCGATCGCGGAAGAAGTGGCGTTCGATCATACGAAAATTATTAAGCGGCTGGCTGCCCACAGTGAATTCCACACTGCAAATAAGGGAAACTTACAAATTGAGAGGCATTTAAAACAAATGCAAATACTGTATAACCTACGTGGCTCCCACTGTTTTGAGGTTGAGAAATGCCGGTGTGAACTGATAGCGCACATAGCGTCCGGCATTTGGATCGGCAGTGTCATCCAGTGACAATTTCTCGGCAGCCGCCAGCATGGTTTCATCCGAGGACAGTCCTTCCGGATATTGTTCACTCGGCGGTTTGGCGATCTCGAAGAGCACAGCGCCGCTCTCCAGGTCGCGAATCTTGAACCGCGTGAAATCAATCTCGAACACATTTGCATTGGCGGAGCAGAGATAGTCGTCCGTGATCTTGGTCAGATGGAGCACCTCGTCGGGAGTCACGCTGGAAGACTCC


Search Again