CR00393

CRIMIC CR00393

Gene Vps13

CG2093

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p1 OK short band79251

Images

Construct Sequences

sgRNA sequence
AATGTTGGATAACTTTAATGGGG

Amplicon 5' Amplicon 3'
GCCTTACTGCGGTACCCATTGTTTATTGGTCTATTTGCACGCAAGTGCCCAGAAAAAACAATGATGGCGGTGACCTTATCCTTGGCAAAATACTATTAATGACCTAATTTCGTCGCTTCTAAGTGAGCCGTATTCGCAAGTTCATGCGAACCCAATGAATTCTTCTGAGAAAGAGAAAAGACGGAGGAGCATTCAGACTTCGAGGGGTGGGACAACTGTTGCATCTTGCTGTGCGATAGAGCAATTCTTGTGGTTTCTCTTGGCTCTCCATGAGCTCATTTAGTCTCTGCCTTTATATCTTTTATTTACAAATCTACTTGTATAGGGTTTCTGTGTGAAACATAAACAATTCTTCGGTCTTTTATCTGAATGTACTCACTTCACTTCATGTTAAGTGGGTTGTAAATTCCACTTCACGAAGACAAGTTTGCGACAAACCCAGTAAACGGGTTTGTTCAAAGAGTGACGTTCGGCGACAAGCCTGTTTTAATTCGGCTGATCTTGAACTTGGTGACATAATGCCTTGCGTTCATAAATTCATGTTAATTAGCATTTTGTTTTAAACTTATATAAGAGTATTTCATTCAAATATGCTTGAAGTAAGAAAGACCGGGCTTATGCTTCGTTAGAAATGAATGAATATATGCTATAAAATGATATTTTCTCTACAATACCTAAATATTTTGAATAAAACTGATTAGCTTAACTAATCAAAAATGACCTAGTTAAGTCAATGGAATATGTGTGTATATATTGCTTCTATGCAGGGTATATTATTTATATTATATTATTTGCCCAATGATTCATATTTGTTTTCATTTTGCAATTTACAAGTCAAGCGTGTTATATGTACATATATTGTAAAATGCAATCAGGTGAATAACTCTTCTTGTTTATTGAAGCAATCTAATTTAATCAGTTGTTACAACACTGTTATCAGAGTAACTTATAATTAATACTCTTGTATTTAATGTCGATAATTGAACACCACTTGCAGAATTATGATTATTGGCCAGATATGAAGTTTGTAAAGTAAGGCCAAACATGTTCCTATCAGTGCGATTCGACTGGCCTCAA TCGCTTGGTCGTTAAACTATTGACACACAAGCGTAATTCAATGTATAGTATATTCACCAATTGTGCTGCCCATTTTGCATTCCAAGCATAACAAACACTTAACAACTATAAATGCCGCATGCCCAAAATGCCAGACATTGGTAAACAGTATTGACATATTGGTGCGCCCGCTGCTTTTTCCATTTGCGTACTTAACACTTTGCAAAGCCTTAGTCATATATAAATGTAGCTATAGCGCTCTCCCTATGTAATTAACCCGTAATTAATTAATAGGCATTCGCTCCCACTTTTGCAAATGACTGATTACTGCGACTGATAAGACTAATGAAAGCAAATTCTGTCTTTGTTTGGCAGGCGATGTCGTCTTGCAGAACCTCAAGATACGGGAGAATGCCCTGGACGAGTTGGACCTGCCCGTACAGCTTATCTATGGTTACTTGGGTATGTAAAGCATTAGTTTCCAACTGAATTGGATACTCATACACTGTGAATTTAATAAATTTGCAGGCAAACTAGTGCTTAAGATCCCCTGGAAGAATTTGTACAGCCAGCCGGTAATTGTCAACATTGAGGATCTTTATGTCTTAGTTTCACCCAACAACAATGTCCAGTACAACGCCGAAAAGGAGGCCAAATATGAGATGGACCTCAAGAAGGCGGCGCTTGATGCCCTGGAGGCAGCTCGCAAAAAGGAGTTGGAAATGGGTAAGCGAATCTTCTTTTCCATTCTTTGAATGAATCGAAATATATATATATATATTATACTCATTCACAGATCAGCCCAAAGCAGATGCAGGATTTGCCGAAAAGCTAACGGCGCAGATCGTTAACAATCTGCAGGTGCAGATAACCAACGTTCATCTGCGATACGAGGATACCACAACGACGGGTAGTCCCTTCTCCTTCGGCATATCCCTGCATGAGCTCGAACTTTACACCACCGATTGCGACTGGGAGAAGTGCTACATGGCCCAG


Search Again