CR00390

CRIMIC CR00390

Gene ClC-c

CG5284

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p1 short band OK79250

Images

Construct Sequences

sgRNA sequence
AATATTCGGAACCGGCAATGCGG

Amplicon 5' Amplicon 3'
ACAAAGCGGTAGAGGCTAGCTAGCTCTCCAAATTCACAAACCTTATCTTATAGCTTTTTTGCTTATTTCGTTTTTTCAGTCGAACGGCCACACAAACGGAGCCGGCGGCGACGGCGACCTAGACGGAACTTTTCGTGACCATCCGCTGGCGCAGCACACCAAACTGACCACCTCGCTGACGGCGGCGGGCACCGACGACGAGGATATGATTGACATCACACCCCGCTCCAGTCCAGGCGATGTGATCGGCGGCGGCGGAGGAGGAGGAAGCAGCAGTGGCTATCACCGGGAAACGGCCACCGAATCGGACACCGAACGAGATTTCGGACACTCTGGCGGCAACGGCGGCGGCAATCACCACAATCAGCGGACAATGCACCAGCATGTGCCAACTCACAGTGCCTTCGGCGATCCTATGGACGGTGAGTTCGGAGAGATCCATTGCGTAAAACATCCAATGTTGCTGTCTGTGGTGTTAATCAAGATCACGAACATTTGAGTAAGGCGACGTCACC CGGCTCACAGCTGTACTCATTCGCTGGCAATTCAATTAATATGTACAATCATTAGCATACAGACATGTATTGTGGAGACACCAGTTAACTTCATGATATATGTACATACGTATATTAATACAATCACCATTTACACACGTGATGCTAATTTAGCAATATAATCACTGAGTTGTCTAAACAACCAGCTGGCATTTCTATTGGGAATTATTTATTTAAACGAAAAAGAATCAATTATAGTTGTTGGGTAAATACTATCGTATATCTGATGATAATAGCAATCAATGTTTACAATACGCTAGAACGAGTAATATCTGTAAGAACTTTATTCGAGGAATCTGTTTAAGAAAACGTAAACGTTCTTCGTCTCGATACCTGAATGAAACACGAGAAAAATACTATAAATTTTTGCGGTTATAAGGCTCTGGTTCTCTTTGGACTTTGACACCAAACCATTAGAATTAGCGTAATCACGTGTAATGCTACTACGACAACATGATTCGGAGCTTACTGTGTCAAATCCGTAATGTTTATTGTATTATTTATTATTGCTATAGGAGCACTATCCTTCTATGGTTCCTCGGACGTGCAAGATGATATTCCTGGCATTGGGCAGTACGAAGATTTTCACACCATTGATTGGCAGCGGGACATTGCCCGTGATCGGATGCGACATCGCTACATAGTCAAGAAGCGACAGGACTCCTTGTGGGATCTGATAAAGGTATAAGATCGTTTATGATTCAAAACACACCATACTTATCAATCATTTTACTTAAAGGGTTCCATTGATGCCGGATCTGGCTGGCTATGTGTTTTACTCGTCGGAATTGCCGCAGGCTGTGTGGCGGGCATGGTGGACATTGGAGCTAGTTGGATGTCGGATCTAAAGCATGGCATTTGTCCACCCGCCTTTTGGTTTAACAGGGAACAATGCTGCTATCCGGCCAAACAGTCAGTATTTGAAGAAGGCAACTGCTCGACGGTGAGTGAAACTACATTTTCTTCCTGATAAGGCACTAAAACCGCATTTATTTTCAGTGGAAAACCTGGCCAGAGATCTTTGGTTTGGATCGAAATGGCACCGGACCATATATCGTCGCTTACATCTGGTATGTGCTGTGGGCTTTGCTTTTTGCTTCGCTCAGCGCCTCCCTTGTGCGAATGTTTGCGCCCTACGCCTGCGGATCTGGTATTCCC


Search Again