CR00389

CRIMIC CR00389

Gene Cyp305a1

CG8733

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p1 short band OK79249

Images

Construct Sequences

sgRNA sequence
ATCAGCCCGGCCCTTGTTACTGG

Amplicon 5' Amplicon 3'
TCGCAGACGCAGAAAGAAGTTATCTGGTCGCCCCTCGAACACCTCCTGCAGCTGCACTTCCTTCACCATCTCGTGGCCAAGGGCAACCACCACATATTCGCGGCCCAGCTTCAGACCCACCAGGTCGCTCCGGAAGTCTTTTGCCCAGCGCTCGAACAGGATGTGCTGGCCGCCAACAGCACTAGCTTCCTTACGGAACTGGTAATATAATAAAGGAACGAAGGATTAATAACCCTAGTATATTTAATGATTTTGAGAATATATAGGTTTTTGAGATCTTGATGAACATATTCAGCTTGCCCTTTTCGACGAAACGTTATTTAAGATTTGGATTTCATTAAAGAACAATCTAGATTTTGGATGTTTCAATTATCTGTTTCGTATTCAAATAATCTCATTTTAATAGTATTTAAGAAACTTTTGTGAGCCTTACCTGTAATGTGTTTCCTAACCATGGCACAAATCGAGGTCCTGTTTTAGGAATGAAATTCAAAAATGATACTAATTTTAAATATTTGTCTTGTTAGCAATAGAATTTCATATGGAATACAACCGTCCAATTCAATCAATTCAACCTATGCATAGGTATCAAAGTGCTAATCTAATCGCCTGCAAAAGAAATCTGTTAGCAAGCAAAACTACCGAAACGAAAGTGAAAACTCTATCTTGAAATCAAACCGCTTAGTTATTAACTATCAATGCGTTATCAAAATCAATTTCATAACTTTTATATGTGGTCAAATTGAGACCGCTTTTCTTTAGGTGAATAAGATTCCCTTAGAAATTGCATACTAATTTATCACCATTTTGAACTGCAACAATTGCGAATAATAATAAAAATGTGCTTATATACAGGAATGACAGCTATTACGCCCATAATCGTAATCCTAATGCAAATCAAAAGCTGCATTGGTAAGTGGAATAAATCAGCCCGGCCCTTG CAGACCAGTTAGGCCAGGTGTCAGAAGTATGTGACGATTTTATCAATAAGATATATTAGCATTCAAAGCGTGTGCCGTCTGGTTCCCCGCCGATTGGCCAAAGATGCCTCTGATCACCATTACGAGTTGCTAATGAGCCCACCAATTAATTGGTCGCGGGGCAGGTCGTATGTTCGCCTATATACAAATATATTTTATAATAATATGGTTATTAATGCAAAGAATAATGCTTCTCTTCTATTAAATATAATTAATTGGCTAGTTTTCAAAAGCAAACTGTACCCACGATACACAAAATTGGTATTCTACGAATTTTAAAGCAAATCCATCGTTTGTTTGTGCACCAACGCTTTAACTTCTTATCTGCATTTGGGATTCCAGGAAAAGTTTTCCAAAGTGCAGCACGAGAAGAACTCACCTGGTGGAAAGTTCTTGGGACGCCGCGCCGAGCTGATGAGTGAATAAATCACGAAACCAATTAGAATCGCGCACAGAAATATGAGGGCACTCATTTCAATATACTATTTATAAGACCACCGAAAAACGAGACCGACGTCCAAG


Search Again