CR00381

CRIMIC CR00381

Gene CG12512

CG12512

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p2 OK OK79248

Images

Construct Sequences

sgRNA sequence
ATGCCCATCCTTATAGATGTGGG

Amplicon 5' Amplicon 3'
TCGTGACAGGAGACAATCGCCTCCACATCCCCAAAATTCGAAGCAGATAGCTCCAACTGCTGGCCAATGGTGCGATATACCAAGGGATCCTTACCAATATGATGCTTATGGCTGATCAAGCTGGGCATCGAGGTGGAAATGCTGCAAAAGAAGAAGGTAATGCCATTTATTAATATAAGTAAGCTAAGCTGGTAGGACGAATAACTAATAAGATAATATTCTTTATATCAGAATTCTTATAATCATTTGTTAAAAACGCATGCCTGTGATTATTTTTGAAAGATTCTACGTGTCACAAAGCTATATTTTACCATGGGCGGTTTGCGTTTTCGCTCAAGGGGTTTCAGATTTAGTTAATGTCGAAGCTTTTTCAGATGAAAAAGCTTAACACTAATATCGATGCAAGTCATAGGAGTTTACATTTGCAAACATATATGTTTTATCACTCGATAGTTCTGCTGACAGATTATACTTTCGAATTGTAAGCGTAACTTTAGCCGCTGCCAAGTGGATAAGAGGGGGTGCTTCAGAAGTCGCACAATAATATTCATTTAGTAGTGGCCAATTGTAAACTATGCAATTTATATGCTTATACATATTTGTAAATGTAAACACTTGTAATGTGAAAACACTGGCTATCTGTTGCGGCGCTATGATAATAGATCTTAGACTTGCGCTTTTGGCTTCGGTGCTGGTCATATACATATTATCATCAAGCGAGTGGAAAGTTCTGCTCACGATTTGCTTATCTTTTGAAATTCATCTAAATTGATACCCGATAATTAAAACGACCTGTTGCTGGTCTAAATTTGAGCACCACTCACCCAGCCACGCCCCCTTTAAGTTTGGTTCTAAATTTGAGGACTTTTACTTAGCCCTAATGACTACCAATTACTGTGGGCAACTGTACCTTCTATCTGGAATCAGAAATATTACGCAACGTGGCGTAGGGGGATGTGGTATATGTGAGGGGCATAGGGGGGGTTGTATATAAAACTGGGCACCCCAAACAAAACTGCGCAATAAGATGGTGGAAACTTCCCAACCCTTCTTCACCAGCAGACACTGTGACCTTGGCCCC TGGGCATCCTTAAAGGTCCTGATCCTGCCTACCTGCGCATCGAGTTGAAGGCACATTTCTGCCTGAGCATGTATCGGGAGATGGTCTGCAGCTTGCTGTTCATCTTGGCACTTATCACAGTTAATTGTTATAAACAGCTGTTTTGTTTTATTATATTTTCATAATATGCACAGGTACACTTTTCACTAAAAACGACTATTAGTTTTCAATTCAGTTCCGCTCGGTTTCTATTGTATGGCAATCTAGGAACGACCGCAGTCCGTCAAGTTCTGAAACAAACTGAGTGTGGGGGGGTCTTCTAATCGCCGTATGGTTCTGCCAGCTTTGCTGCCTCTGTCGACGCCTTAAGTTTTTTTTTATATTTCATTAGTTTTTTTTTTCTTTATAGCTAGACAAGATCGTTGCCGGCGTTTGTTTTGCTTTCGGGTTTTAACGCTTTTATTTTGCTTGCTTTGGCAGCACGTGTGTGACTGTGAGTTAGTATTGTGTGTGTGTTGTGCTTTTAGTTCTATTATGTTTGCTTAATCTGTAGCTTTTGCAGAGGCGTGA


Search Again