CR00380

CRIMIC CR00380

Gene CG4911

CG4911

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p2 OK OK78902

Images

Construct Sequences

sgRNA sequence
TTTGGCAAGCTTTCAATGTGTGG

Amplicon 5' Amplicon 3'
AGGCATACACAAGGGTCAGCACCAACTCAATGCTCGAAAAGTGATCCGAAAAGTTGGACCAGGCCGTCTCCGACACATCGGGATGCTCTTCGCTATCCAGGCCGTGCACTGCGATCAAAAGTTTCCGCAGCGGAAGCACCTGGATAGTGTGCAGCAGTTCGTCAGAAAGTGTGTCGTAGTCGAGGGAGAGCACCTGCAGGGCGGCGCATTTCTGCAGCAGGGTCGAGTCCAACGAGAGGATGGGATAGTGACTAGGATCGTACTTGATGCTCGCGAGTGTCAGCTGCAGCAGTTCCTGTGGTTTTCCCATAGCCTTTAGAAAATCATGGCCATAGTATGAGAGGGCCTCGATGGCTCCAAGGTCCAGAAGCTGGCAGGGCTGACGCTTGCGGCTTAAAAACAGAATCAACGGCTCCACAAAGCATCTGTTGGGATTGTCAGGATATCTAACTATTGAACTTTTTATTTATTTCTAATGGTACATACTGTTCGATGGCCAACAAGTGCTCGCTATGCATGTTTCCGATGGCAACAAGGCCGACATTGTGGGTTTGGAAACGCAATTTCTGGATGTTATCACAGTGCGCCACTCTGTGGGATGGAAAATGGTTAGGTTGAGTCCTCATTGGGTTTTCTAAAGCAAACTTACTTGTATAGAAGTCCTCGCATTTTCTGGATGTGAACTGCATTTTGAAAGTCGAAGACTACTATCAGTTCCATGGCCAAGTTGGCCATGGAGCGATGGAAGAAGGCCAACTGATCATCGCATCCCACATCCAATTGAAAGCGAAAGTTTCTAAAATAGCTGAGGGGTGAAAAATAGGTAATGATTAATTATATATAGATGTAAATACTAAATTACAAAATTGGGCTTATTTCTTTTCTATTTGTTAGTCCAAAAGACCAATATAATTAATTTAAATAACATAGGAAAATTACTATAAATACAATAAATGAATCAGCATAGAAAAGGTAAGAAAAATAAGTATCTTTCTCGCAATCGCTAAGATCGCAATTTACAGCTCACAGCTTATCGCATCAATTAATTTAATTAATTGCATTTATTGGCAGGGGAATTCCTCTTATCGTGGACTTTCCCCTTTTTTCAACACTAATATAAACAAACGGACCTAGGTGC GCTTGCCAAATGCGAAGAGTACAACATATAAATGTCGAACAAGTTTTGGGGTCTACGATTCGTTCTTGCTTGCACAGATGTTTTTTTGCGCTTGATTAACCCACGGCTATATAATGTAAGGGGCAATAACAAAGGAAATATACCCAATAAGTACTGAAATTAAACATTTCAGCCACATACACAAATACCTACACCCACACGGATACGGACACACCCACACAGTGACAAACTTACCGTTTTTGAAATAAGGCATGTCTCCAAGAAAAACATACACCCGCTGCCGACCGACGATCCTGGGGATTTAGATAGTCGAATATGTGATTTAGTGCCACCGATGGTATTCTGTGCCATTCTGGTTGGCGTTGGCTAAAATTCATTACTCGATTTAAATGTTAATTGCGTTTCAAACAATGAAAAGTTGCAAGTGCAGCCGAGTACGCTGCACAATTTAAAATGCCAAATTAGAGTGACCGTCGCACGAGGTCGCAAATATGCCAAGACCAAGAAAACAAATATGAATACAAGCACAATTTTATCTTAAGCATATACGTATGAAATTAAACGTCAATTAAAAAACAATTTATGCACTTAAATTAGGTCTAGCCATTTTAAGTAAGCCGAGATAATTATTAATTTAGAAATTTCAAAGTGAGTAAAAATGCAAAGGAAATAAAAGTGTTGCTGTCGTATAAAATGACTGTATAAATTTTGTTATTGTTCTCTTATCAACGATTAAATGATTTCAAATTAATAACTGCATTTCAATGTTTCCTAATTTCGGATAGCAAAAAAAGCATCGTAAGTTAAGGGTTAATGCAACTACAATGCCTAGCTACGGCCACACTGATTGAAGCCGTGTTATGGTAACAATCAGCTGTTCACAATGATAACAACTCGCACTGCTGATTCTATATAGTTGTTTACGTTGATTATTAGTTTTATATTAATTAAAAATGTCAGCTTTGCTTCTTTTACGCACCTGTAGAAGTTCATCAATTGCTGGCATCTACAAATACACATACCAAGGAACAACTATTGCGAATCACACATGCAATCATCGTCTGTCGTCTACAGAAGCGGCGGCCGCGAGTGTCCAACTGGCAAATGCCGGTGGATTGGTGGGATATTGGCAGACCTTGTCCAACAG


Search Again