CR00377

CRIMIC CR00377

Gene Rx

CG10052

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p2 no/short band no/short band79247

Images

Construct Sequences

sgRNA sequence
CCCGGCTTCACCCTCCATCGAGG

Amplicon 5' Amplicon 3'
TCCGATGTTGGAGGGAGTCTGCGGCCGGAGATGCCGAAGGATCTGGCATGGAGCACAATGTCGGCATCGTTTGTGTTTGTTTGCGATGGCATCCAATTTCATTCTTTTATGCGACTTATTGAGTTTGCTCTGCGCCGCTCCACCTCTCCTCTTCTCACCACTCCAATGTGTGTCCTTAAGGTCCTGGTCGGGCTCGGCTCGGCTCTGATGTCCCGATGTTCTGCTCTTCTGATGTCCTGATGTCCTTGCCCGGCCAAAAGGGTGTTGTTGTCTCCAGTTTGAGAGCCCGTGGCAGAGTTTAAAGGCAGCCTATGCCGCGTCCGCCTCCCAGGCGCATCCTTGCCAGCGCTTAAGCCACGAAACGTGTCCTTGTGCGCGCTATTTGCCTTTCCAGGACTTTGGCTATGATTGCGCTTTTCTGCGCACCACCCACCTGATGGCTAATACAAAGCGAATCGGCCGTGTAGTTGGAGTTCCGCCACGTGCGGGGGATTTGTTTTAGTTTTCGGCTCGGTTGTCTCGTATTCACCGTGGCCTGTCAACACATTTTAATATAAATGCATAAATCAAACGGAATGAAATTATAAATCATACACATGACCCCCGGCTT TTGCAACCCCCGAACACAAAACTCACTTGACATCACGGATTGCCTTGCCCGCCCTCAAGGTTGTCACTCCATTTGTTTGGCTTAGAGCGAAATAAAATATATAAACCAATGTAATCAAGCGAAGACAATTACAATTACAATGAAATTATTTCGCATTTTGTCGGTGCTTTTTTTTTTAATGGTAAATTGCTTTTGCCCAAAAATATCCTTGCATCTCTGAGAAAACAGCCAGCGGAGCAGCTGTTAATACGACCCTAAAATGCTCGAGTGTCAAGTGGAAAAGTGGAAAGTGGAAAAGGGGGAGTGGACGAAATCGGTGGGTGGGTGGTTTGTTTGGAGAGGCCATCACACCCCTCGGTGATGGGAACATTATGAATATTATTCAATTTGTACGCCTAAATGCTTTGTAATGAGTTGCACATCTGTTCGCTTCAGCGAGTGTTTAATACATCATTTTTTGCCTCTCGGAGTCAAAAGGCAACAGGATAAAGGATAAAATCCAAAGTGCGGGTGCTTTCGAGTATTAAGTTTTTATTGCATTACATCCCCGTCCTCTGTCCTCTGTCAGATGTCAAGGATGCACTCAATCCGGTTCACAGTTTCGAGCGCGATTCAATTATGACTCTGATTTCGGATTGTGTAATCTGGCTAGGGGATTGATGAACCTTGTATACCTTGTATACCCACTTCGCATCCAAAACATTTGGATGCCTCTCGGCTGTCAGTTTAAATGAGCATTGGGCTTAAGTTGTCAAATTAGCGGGCAACAATACAATTTCAATTTCGATCCACAGTCAATCAAAATAATGCCCAGGCCAGAAAATAAACGTATAGGGAATTTCCAAAGGTAAAAGTAAGGTGGAAAGGGGGACTGCATGCGATACGTA


Search Again