CR00375

CRIMIC CR00375

Gene Hs3st-A

CG33147

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p2 short band OK79246

Images

Construct Sequences

sgRNA sequence
CGGGAATGATGAGGGTGAGCAGG

Amplicon 5' Amplicon 3'
GGCAGAGGATTGGAGACAGGGACAAATGAAGCGTTACAAATGCTTAGTACTGCGAAATGGAACTTATTCCAGTTTTGTCAGGATTAGAGTGCTTGAGCCCGTCTTTAAAGCTTTGCGTTCGGCGGGGATTTGGGCTTAAAGGCTGCCTGTCTGCCAACCTAGAAAGTGTGTGACAACGACAGAACGAAAAGGAGCAGAAACAGCTAGAGAGGGAGGACTCCTTTCTGGGTGGCGCTGCGTTTATGCAGATCGCAGTCAAGTGGCGGGCCGCCTTGTGGAGCGCGAAACGAGGCCAGTCGCAGCCGGGCTGGTACACTCAGAGAAATACATAAGTGAAAAGATATGGGCTGGTAGAAGTTGCAATCATATTGTTAAGATCTCAGATTAAGTTCTCAGAACGATACTTATTATTCTTTAAAAACATTATTTTTTTAAATAATAGCAGATATTTCTAGGTAGGATTTTATAATTGTTTTTCTTTCCGTGTTGTTACTGCAGCTGCGGGCTTAAAACGGGTTAAGAAAATGTAAAAAAAAAAAAAAAACAGCTGGGAATATAAAAAGAACTTAAAGCGTGTCGACAACTGGCAGAAAAAGGAATGGGGGTAGAGGGGATGCAGGGTATCCAGGGCGAAAATATAGAAATGGGGGGTATGTAGAATGGCAGGAAGTCGGTCGGTCTTGCTCTGAGGTTGCTCCGTGCGCCGCAAACGGCGCCGTCGAGTGAAGTGCCTCGACTCCTTGCGGGCCTCTAGCCCAGTGTGTCGTTACTTTTAACGAGGTGTCGCATGCGAAGTGGATGAGGCACTGGCAGCCACTGGCGGCGGCAGGGAGGAAACTCCAGGGGCGAAGCCACCAGTTGCCACACGTTTCCCAGCCATGCCCTGCCCTGCCCCACCAGTACCACCACATCACTTTGCTATGGCTATGCCTTTGCCACCACGCCCCTACTCTGTATATGAAATTGCACTTAGCCGCAGACTGGCAGCAGCTCCTTCTGTCACCTGCTAATGCCCGACATAGCGGAC CCCTCATCATTCCCGTACCGTGCAGCTGCGGCATGCTGCAAATGAAGTCATCCATTAGGCCACGTTACGTATACGCCTAGTGTGCTGCAATGTGGTGCTCATAATAATGCTGCCAGTGTTTGTTGCGGTCTAAGCGGAAACGTTTATAATGGAATTCGCTTAAGCGCCGCCGGACGTGAGCGTTCAGGTGGTGGCTGAAAATGGAGGACTGCGTCCAGAGTGTCGTCTTGCTAATTTAGCTAAAGGCAACCGGAAAACGGGAGGAACAGTAGTGGGTTGAACAGAAGTGCTGGAAAACCGCCAGCCTTAATTACTCAGGACAGCCGGCAGGGCAATCTAATTAGCTGAAACCAAAACCAAATCCTAATCGATGTCCTCTCTATCTCTCTCTCTCTCTCTCTCTCTTATAGATGGCTACCGAAATCGGCAATGCGGCCGGCGGGTCCTGATACCTCGCCCACGGACTGCATCCTGGTGGTGGGCGTTTCCCGTCCAAAATTGGCCGTCGTCTTCCTTACGGTCATGTTGATCTCTCTGTTCCTCACCTTCCATGTCCTGTACGATAGTGCCGTATACAATATCCAAGCGGCCCAGGCTGTCCACGAAAGGCATCGTCTATCTATGACCGCCTCCGCATCGGCTCTGGCATCCTCCTCCTCATCGTCGTCCAATTCCGGCTCCTCCTTCTCCTCCGCCGGTGGCGCCTCCAATCATCTGCCCGTGTTCGTAAAGCCCGTGCCCAGCTCCAATCAGCTCAGCCATCCCATG


Search Again