CR00370

CRIMIC CR00370

Gene sv

CG11049

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p2 OK OK78901

Images

Construct Sequences

sgRNA sequence
CTAGATTGGCATGTGGCCGCTGG

Amplicon 5' Amplicon 3'
TGTTCCCAGCGTTTCTTCGATAAACCGGTAAGAAAATACTAGAAAAGAGTTTCACTCCCAATGAAGTCTCAAAACAGTTTAGAACGTATATGCGCACATCCGCGATGCGGATGTGATCTGAAGTTTGTTTGCTGTCATGCTGCTAACATCCGTATCCGTTTCCTTAAAAACTAAGCTTGAAAAGAAGTCAACTTCATGCAGTACTAAGTATATTACACCAAACCTTTCATCTAATAAAAATATCTAAGTAGTTTTTAGCGTTCATAATTGTGGCACAATGCTTGACACACGACCACAACACAAGCCACTTTCCCTTCTAGCATCCGGTGTGGCTTTATTGCTGACAACATCATCGTAGAATTTTGGCCGTGCCACGTGGCAGTTCCTAAGTCGACACTGTCCCACATTGCTATTATTTACGCGCATCCACTTTGACCATAATTTATGTTGGTAGCAGTCAACGAGGCCAACGAGAGCAGCTGGAAAACCTTTAATCCCATGTTTTATTTGAAATTAGCTGAACCCTGTTTAAATGTAAATTTTATGAAATTTTAAAAATGTTAAAGCCCAAATAGCCGAACGTCCTAAAAACATGTAATTACGAAGGTTTTTCTTCAATCTTACGATTAGTCGTTTTGGAACTATGGAATATGGTTGTCCCGTGTTACTCGTACCTGTTATGGCTTTCAAACAAGACTAGTTTGGTTAGGAACGAATATGGACCCTTATTATAAAATTTTTTCGAAGAATAATGTTACAAAATGTTCTTTATATTTAACAAAAAGCATACAAGTCATTATCTGTTGATCGAGTATTTCAAATGTCAAGTCTCATCTCTATTCTGCATGCTAGAAAATGTAATTTTAATTTTAATTTTTAACCGATCTCAACACGTGCAGTTATAATCAATTCGATTCGTGTTACCGCCGGGTCCCGCAAAAAGTAACAAACGTCTAGATTGGCATGTGGC AAAAGTTGCGACGGACAAGGGTAATTCATGGTATAATCAAGGAGGAAGAAAAATTTCATAATGCGACAATGTGTGATGTGATGGCACTTGAACGATGATTAGGGTGGCGGTGATTCAATCGAATAAAAATTGTGCGTACGGCGGTGCCAGGACTCCCCTTATACTGATTCCCAGGAGACTGTCACTTAATAAAGTGACTTTCATAGCACTCAACCAATTTTAGTTTTCAGCCCTCCACTCAAATACATTGAAATGTCCATGAAGCGGGATGTACTTTTCGCGCATCCCAAACATATGTCTCAATTGTGTGCACTGTCGAAATATCCAATTGCTCATCCCGTTTCAAGCTGGTACTCAAAAATATATAAAACCTGAAACTGTTGTCTTAAGGGCACAAACTAGGCAGAGTTAACTTCTGCCCTTACAACCCCCTGTAGCATATGGTAACCTTAACAATCTGTAAAAAAAACCTAAAAGATACTTAAATCAATGCTATCCCGGAGGTCC


Search Again