CR00369

CRIMIC CR00369

Gene tio

CG12630

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p2 OK OK79245

Images

Construct Sequences

sgRNA sequence
ATTCGATACGGGGTTTCCCGAGG

Amplicon 5' Amplicon 3'
CATGTCGCCTTTGAACGGTGGGTGGTGCAGCAGTAACGGTACATCGCTCGACCTACGACTAAATTGCGAGTGCAGAAAATAGTGTTCACGGAATTAACAGACCTCGAAAATCCAAGTGTAGGCGAATAAATAAACGAAATTATCGTGGAAAGCCATCAATAAATCACCAAATTAATAGCCCTGACGAGCACCCACGGCATACGCACAGCTGTTGTGTGTGCAAAGTGAGAAGAGGAAGCTAAAGGAAGTGAAATTGGCGGCAGTTTGACCGCAACAGCAATAAAATACGTCTGCAACCCACAAACGCACGCTCACATACACCCGTTCGTCATCGAATCGTCGTGGTCCTCCGCTTCCCAGTCCTCGCCCGCCCCTCTTCGACACACGAACCATTGTGACATTTGATTTATATGACGTGTGTGTTTTTGATAGAAGTTCAACACGAAACTGTCACACAAACACACGTATGCTCGCCGAGGAATTTATTCAGTGAACGAAAATAAAATCAGAGCTCCGTACGCACTTGGCCGCAGTGAAACGAATCCGCCACCATCGATGAGCAGGCGGACGAAAGTCGGAAGTATCGCCAGGCAGTCCAGTAATCAAACCTTTGGAGAGCGAGCCCGGATACCCAGTTTTCTACAAAATGATGCTGCACGAGGCCGTCATGCTGGAAATCTATCGCCAGGCGCTGAGTGCAAGGTGAGCGCTTCCTCCGATTTGCTGTTCCACGCCAATAGCGATTCGATACGGGGTTT GAGGAGGTTGGGCAGTTCCCTTTGGAGATGCAGTGCTTTATTTCGATTATTTAGTCGAAAGCTGCATAAAGTTAATTGGGCATAAATAAAAGATATAACTAAAACAACGCAGGCGGCATTTTGAATCGAGTTTGTTCACCCTGCTGAAAAGTTTGTTGTGAATGCAACTTCTTGCTGTGCCGATTGATTAGTGTGAAGTTTACTCCATTTGGCACGGTTTGCGTTGATAAACGAAAAAATGCCGCTTAGAAAAGATCTTTCCTAGGTATTAAAATTTTTATTTTCTCAGCGCGATTAATGTGGCTCTTCGTATGAACAAATAATCAATTAGTCATTACAATATAATTATTCTGCTCCACAATGGAATGCTTGCTTTCCTAGTGATACCAAATTGACAGAAGCACTGTTGCTGTTTTAATGTCCGATATTTAAAGAGCTTAAAGTACGAAATTTTAAATAGAATATATATATATACCTTTTTTTCGCATGTAATTGTGACTCAATTCTAACTTCCATCACCTTCGAATTTTCATTTTAGTGAGTTAACTAGTCCGCGATGTCAGTCTCGCGATTCCAACACCTCAGCTGGAGCGGGTGCTGGAATGGCCGATGTCCGATGTCCATCGAATGAGTCGCATTGTTCGGCGAACGACCGTCTGACCCCAGCTGCAACGCCCACTCTCACGCCTACTGAAGCAACCATCTCCCCAAACTCGGTGGGACTTCCCCTGACGGCGACCCTTCCTCCTGCAGCTGCAGTTGCTCTGCTACCGCCCCAATCCGCCGCCATGGCCGCTTACCTAGCCGCTGCCCAACAAAATCACCTTCTGCTAACAAATCCATTGGCGGCAGCAGCTTCACTGGTCCAACATGCAACGCAGCAGGCAGTGGTGGAGGGGGAGGTGGAGTCGCCGGCCCTCGATTTTAGCAGAAAGCGGCCTAAGAGCCACGGAGACGACGATCAGGAAG


Search Again