CR00368

CRIMIC CR00368

Gene stan

CG11895

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p2 OK OK78900

Images

Construct Sequences

sgRNA sequence
CGAGACTTCTGCGACACACTGGG

Amplicon 5' Amplicon 3'
GATGCCGCGTACTTGAGTGACAACATATACGACAAGCAGCGAACGCTGGGCAGTGGCTACTTGGGCGCCAAGTCGGAGTCGCCTTACCTGTCCAAAGATCGCATAACACCCGATATCTATGGATCCAGGGATGGTCATTATAGCCTCAAGAGACAGCCTGCCTATGCAACTGATTCCCTGCACTCGGTTCACTCGCTCCTAAAGAACGATTACCACCAGCAGCAACAGCAGCAGCAGCAACACCATTTGCAAGACAGATTGTCCGAGGGATCGGATAAGAATGGCTACCACTTTCCCTACACCGCCGAAGAGGATCACCTGCCCGCCAGGAAGCTGAGCCACACCCAACCGCCTTCGCTTCACGGATCCCAGCTGATGCAGCCACCTGGAGTGGGCCTGGTCAACGATGTGAACAATCCGGGCTTGATGGGAAGGCACACCCTAAATGGAGGATCCCGACACAGTTCCAGAGCGTCCTCGCCGCCCTCCACCATGGTGGCTCCCATGCAGCCACTGGGCCCACTGACAAGCATCACGGATACCGAGTAAGTTGGCCAAAAGGTCTGCAGCAAGATTGTCCAACCC GTGTCGCAGAAGTCTCGAATTTTGTACCAAATTCCCTGGAAAATCGTATGGCACCATTGGTAACATTCGGTTTTGGGAGATTTCTGTGACATGCCTGCTCCTGTTGGCTTCGGTTTAGGTTTTGGTTTTGGTTTCAGTTTTGTTGTGGTTCTGGTGACCAGTTAATGCTTCTTGTGCTCCTTGTGCAGCCCATCCTGTCTCCTGATTTGAGTTTTATGTTGGCCTAGATGATTAGTTTTGGTTCGGGAGTTCCTGTTCGTTCTCCGTTTTTGAATCCAGCAATTAATCTGTGGTCCTTTGTTTCTGATTCTCTTTTCTTTATGGCATTCGAATCAACAACTACAATGACATAAACCCTTTTGTGCCATTCGACTTTTCCCACAACAATGAAAACTGAAAACAATGCAAATGAATATGGTACAAACAACACACACTCACTGCACGCCTACACACACATGCACACTCGTACCCACATATCATATACATCTTTCTATACGTATACATGTCCATATCCTTTCAGCTGGTCCTGGGAACGTTTGAA


Search Again