CR00365

CRIMIC CR00365

Gene Wnt6

CG4969

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p2 OK no band79244

Images

Construct Sequences

sgRNA sequence
GGTCAAGTTGGAGGACGGTGTGG

Amplicon 5' Amplicon 3'
CAGTCAGTGCCCCTCATCTGGTGATTTTTCTTCTATTTTTTTTTGTTTTTTTTTGGCTCTCTCAGCATGTGAAATGGTAATTAATGCCAGGCGCGGCATTAATGGGTTAAGGCAAACAGGGGGTGGTGGGTGGCCAGTGGCCCAGTGGCCACTTAGTCTCAAGCTGTGCTGGCTCCACAGTCGGTGGTTGCATCAACAACATTGCTCATACGCCCCGTGCACCACGAGATTAACGCTGCCGCGAATTTGGCACACTTCATGAGCCAGCAGCAACAAGCACCCCCAACAAAAAAGCAAAAACAACACAATAATTATGTTCAACTAACGAGCAGACAAAAGTCGGCCAATTGCCAAAATCCAATGCAGATGAGTTGATTATGAGCAGCAAAAAAGCGTCTCTGACACAATTCGCTCGACATTAACGAGAATACCTGTGCCCGTCCGTGTCTCTAGAGAAAGTTTCACGTTCAAGTTTCTTTCCCCAACCTTAAGTCCCAAAAGTAGCTAGTTACCGTACACTAGATCGCTGCAAATCTCTTAGTCAAGAGTCATGCCATTTGTTTATTTTGTTAATTTGTCGCTTTCCCCTTGTTACATTGACGAATGTGTCTGTCTTCGGATTGTCTGCCAGATGCATCATAATTAAATTGGATGACGAACCAAAGAACGCGGACAGACATGGGTCAAGTTGGAGGACG CCCATAACCAGGTAGAGGGCTTGGCCATGATGTCTGTCAAGCATTCTGCGCCAAGTGGCCCAAGAATATGTGCTCCTCGTCATCTCGAAGGTGTGATGATGCCCTGGGACCAGCGGCTTAAGAAAGTACGGAAGCTGATTAATACATACAAAAAATATATAAAAATTTGTGTTTTGTCAGAATTTTATTACATTATAAAAGGACCATACTGCACATTAAGTATTCTATTTACCTTGCAATTTCCACATCATAACAAAATACTTTTTGATCTCTAATGGCGCTGGCATCCTAAGCTCCAAGGAATCCTTGTCCAATGGCCGGTGCCCAATTCCTCTTTCCCACAGCCTCAATCATCGTGATTAAGCACAGTTTAGACATCCTTGACATGAACATGACCATGTCCGTGCGCCGATGATCGTTCCCTAGGCCCAGCTACGCCTATTTGAGCCGTAATTAAGTTAAACGTTGTCGCAATTTGCGCACCTCAAAGTCACCAAGCCCAGAGATTGATGTCGCCTTTGTTGGCCCAGAGAGTTAAGCCAGGTTAAGGCACTTAGGGCTAAAGTTGAAGTCGTGCCCTGCCCACTGGAACCAACGAAGGAGTCTTGTTAAAGGAATGACATTGCCTGGCATCGCAGAAGACACTCATAGTAAATATGCCTGAATTATTAGCCAGCGTTTTTGCTGCGCCAATTGGACATGGACATGTCTGGGAAACAGTAAGAAAGGCTAGCTTAACAGATATGAGCACTAACTTAAAATATGTTTAGAATATATAAGGGTAAACTTAGTGCTTGAATAAAAATAGAAATAATAGCAATGTGGCATTATAATGGTTTTATTCCCTCAAGCTCGGGACGAAAT


Search Again