CR00363

CRIMIC CR00363

Gene Bx

CG44425

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p2 OK OK78899

Images

Construct Sequences

sgRNA sequence
CATTTCGTTCGCCTCCTCTCCGG

Amplicon 5' Amplicon 3'
GAGAAGTTCACCCTTGCGGAGATGCCATTATGGTTAACTTTTGACTTTTCTATAATCCTGTTTACGCTAGAATAATATAATATAGAACTAATGCAAATTTAGCTTAGACTAATATCAAAAGATTGAGAGTATGATGGGTCATGGTTATCCCATATTTCACCACGTTATCCATAAAAATGACCAGTGGAGATGCATCCCCTCCTGTTGCTAATCAATTTTTCACGTAAATTAATTCAATTGCCGAAAAAATCCATTGAGGCGTGGCCACATGGCCAGCGGCTGCTTCGCTCCGCCTTGTTGGTTGGTCGGATGGTTCGAATGGCCACATTTAAAATGCGGGCTTTCATTTGGCAAACAAAAAGACTTTTCCTGTTGAGTCCTACCGCTGAGTCCTGGGTCCTGTTGCTGTTTGGGAAATGCTGCAAAATGCATTGCAGTCGTCGGTGAGGTTTGCATAATTTCCTGTCGTCAGCACTGGACGACGACATCCTTGCTCTCCTGCGATTGGAGTCGCATCCAAGTCAAATCTTTCGTCCACGCGAATTTTTCACAATTTTTTTTCCCCCCCATTTTATTTTGGTATGTGTGCTTCCTGTTGACAATTTGCTGTTGGTTTCTTGTGAACGACGGGGAA CGAACGAAATGCCCGGATGTGCGAGTCCCGCACAGAGGCACTCACTTATCAACATGTCCGTGTCCATTTCCATAGCCATCACCATTGCCATCGCCAATGCCAATGCCATCGCCATCGCCATCGCCATGTCACAGGTGCGCTCAATGCCAGGCCAGCGGCAAAAGAAGCAAAAGTTTCGACTTTGTTGACTCGTTTTCATGGACTTTTGTTGCCCTGTTTTGGTAGATAAACAAAGCGCTTTTTTGCCCGCTCCGGCCGGCCAGATTTCTGTGCACTGCTCCCTGCCACGCCCACATGGGCCGTCAATCGATTTGGCCACGCAACCGAAAGCAGCGGGCCAACAAAATGTTGACGTAAATCAAAAGCCAAATTTCATATCCGCTGTAAGTCTGCTGTAAGCTGATTTACTCAGACTCCTTACCAAAACGGATGCAGTGTGTTCCCGTGCCCCGTCCTCCTCGGGGAATCAAACTTTAAACGTTTCTTTTTTGCATACGCCGGCGGAGGAGGAGGGCGTAGAGTATTGCATCAGGATAGCAGAATATGTGATGGAAAGGATGGATAAAGTTCGAGGCAACTTGCAAGTTGTAGCGGATAAGAAAGTAGTAGTAGTAGTATCTCTAAACGTTTACCCCTTGTCTTTTTTATTCTAAGGAATAAGCACAATCATCGTTGGTCTTTCTCACTTTTCAATACCAGATCTAGCTGGTTTCAAAGGACATCAACTCGTCTGCTCAACGCGACTCCATCTCA


Search Again