CR00361

CRIMIC CR00361

Gene Mccc2

CG3267

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p2 OK short band79243

Images

Construct Sequences

sgRNA sequence
GAACAGACAGACTGGGGGCACGG

Amplicon 5' Amplicon 3'
TTATCAGTTCGGCCACCCACAACTGACGTAACTTTCGCCTCCACTCGCGTGGTAATTTTCGCATTTAGCTCCCTTAAAATCCCACCCCCCACAAAATGATCCGGCTTAATTGGCTATTCAGGAGCTCCTCGGTGCTGCTGCGCAGCCAGGTGCGACTGCTCCATGTGGGAGATGCCAATGTTTTGCATAGCGAGGTAGACAAGCAGTCCGCCGAGTACAAGGTGCATATAAACAGGCTGTATTTATGTTTACATACCAGCTAAAGTCCAAGCTTTTTTAGGAAAATGCCAGAGAGATGGCCAGTTTGGTTGGAGATCTGCGGAACTTCACCAGCCAGGTGCTCAAGGGAGGCGGACAAAAGGCCATCGAGCGACACACATCGCGGGGTAAACTCTTAGCCAGGGAGCGCATCAACCTGCTCCTGGATAAAGGATCGCCCTTCCTAGAACTCAGTGCTTTGGCCGGACACGAGTTATATGGCGAAGAGGTGGTCAACTCCGGGGGAATCGTCACCGGAGTGGGACGCGTTTGCGGGTAGGTCTGAAAAATCCAAGTTGATCGAAGTTCCACATCAGAACTTTTAGCGCTTGCATAGCACATTCAGTCTGCAGAAGACAAGGTTACGCGTCATTAGGGTTAATTAGGTCGTAGATTATATTTAGATTATAATTATAGATCGGCATAAATAGCCGATCCGATCTAGCCG GCCCCCAGTCTGTCTGTTCGTATAAACGTAACGATCTCCGGAACTATTCAAGATATTTTGTGAGTCTCATAGTGAAGGTGGAAAATAAATAAATTGTGTACGAAATTTTTTAAATTATCAAAAATAATATGCAATTTTCATTACAGAACTGAGTGTTTGGTGGTGGCCAACGATGCCACTGTGAAGGGTGGAAGCTACTATCCCATTACCGTTAAGAAGCATTTGCGCGCTCAGGAGATTGCCCAAGAAAACCGCTTGCCCTGCATTTACCTTGTGGACTCGGGTGGCGCCAACCTTCCGCGCCAGGCGGATGTCTTTCCAGACAAACTGCACTTCGGACGCATCTTCTACAACCAGGCAAACATGTCGGCCCAGGGAATTCCTCAGATTGCTGTAGTTATGGGCAGCTGCACGGCCGGAGGAGCTTACGTACCGGCAATGGCCGATGAGAGCATCATTGTTAAGAAGCAGGGAACTATATTTCTTGCTGGGCCGCCGCTGGTGAAGGCGGCCACTGGAGAGGAAGTGTCTGCGGAAGATTTGGGTGGAGCAGACTTGCACTGCAAGACTTCTGGGGTCACCGACCACTATGCCTTAGACGACGAACACGCCTTGTATCTGGCCCGCCAGATTGTGAGCAACTTAAACTTGTCCGCCACTAATTCGTACAACGATCAGCTGATGCACTCCAGTCAAGTCAATTTCCAGACTGCTACTCCGCCGTCTGCCGTAGAAGAACCGCGCTACGACGCGGAAGAGCTGTACGGCATCGTAGGTCCCAATCTTACCAAAAGCTTTGACGTTCGCGAGGTGATTGCGCGCATCGTCGACGGAAGTCGCTTTACGGAGTTTAAGAAGCTATATGGTGAGACTTTGGTGTGCGGATTTGC


Search Again