CR00359

CRIMIC CR00359

Gene CG2852

CG2852

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p2 OK OK78898

Images

Construct Sequences

sgRNA sequence
GCACTTTGTAGGTTATAGCGGGG

Amplicon 5' Amplicon 3'
ACTTTAGTCGGTGGCATCGGCCTTGGCCACGGAGAAGGCCTCCGAAACGGGCAGGGTGCCGCTGTTGGCGATGACCACATCCTTGACGGGACGGTCGCGGGCATCAGTGGCCGAGTTCTCGATCTGGCGCACCACATTCATGCCCGACAGGATCTTGCCGAAGACGACGTGGCGTCCATCCAGCCAGCTGGTCTGCTTGGTGGTGATGAAGAACTGCGATCCGTTGGTGTCCTTGCCAGCGTTGGCCATGCTCAGCCAGCCGGCGCCATAGTGCTTCAGCTTGAAGTTCTCATCCTCGAAGCGCTCGCCGTAGATGGAGCGACCGCCGGTGCCGTCGCCCTTGGTGAAGTCACCGCCCTGGATCATGAAGTCCTTGATGATGCGGTGGAACTTGCTGCCCTTGTAGCTGCGGGGTATAAGAGCGTTGCATGATGGTCAGTTTTGTCAGCATGGGAATTTAAATTTAAAAAAAAACTGGGTTTAGAACTCGAAACCTAACCAAAAAAGAACATGCATACTTATAAATTCAGAGAAGAAAAAAGAAATACCCAAGAACTGCACTTTTATAGTATGGTAGACTTAATAACAGTTGGCGTTCTTTGTTAACCCATTAGTGCCGCTTTGTCAACTGATGTATGCGATTGGCCGCTCAAACGCCACGTAATTGCTTCA TGAGAGCCCCGCTATAACCTACAAAGTGCCGCTGATTAGCGGCATCTTTTGCTGGCCTAGCGGTACCTGGCACCCTACTATGTTGGGGTATTTTCGGTACTCAAGTACCCTACTCACCCCTCGCCCTGCGGCTTCAGCGCCAGCTCCTTGAAGTTCTCCACCGTCTTGGGCACCGTCTTGCCGAACAGACCGATCTCGATGCGACCAGCGGGCTCGCCGCCAATGGTGATGTCAAAGAAAACCTACGCAATCGGAAGCGGTTTATTATTAACAAGTCATCTCACTTGATTTATGGCGCAGCAAATGTGTGTGTGTGTTTGTGTGTGTATGTACGTGGTGTATGCAGAATGTAAGGACGAAAGTCCAAGGAGCACGCACCTTCTCGGTCACTTTGGGACCCTTGCTATCGTCGGCAACAACGACGCCGGCCACCAGGGCTACCACGAAAACGGATAAGAACAGCTTCATCGTTCTAAATATTCACAGCGCTTCAGTTTATTCCTCAAGCGACGTCGCCAATGGATATTTCACGACTGAATTTTCGGTTTCTGTTAGTGATGTAAGAAAACTTTGTTGCATCGCCAATCGATGTTTTCCATCGTTTTTTATGTTTTTGTCGAAATATCGATGCTTAAGTGTGACCATTCGATGACGATGTCTGATGATCACACATTCGGGCGGAAAATTCAAATTCAAATAGTTAATACGCCGAAAGCATAAGTTAAGGTTTTCGTACGAAGGAACAAAGTAAGTTCGAAGAGTTGACTTTATTGGTATAGTTTTTAATATTTTAGGGATTAGAAGTCCAGTTTGCATTAGCACGTAGCATTCTCTCTTGTTTTATTGACGGTTCTGTACACAAAAAGTAAGTAAAAAAATATGCTTTTATTTATTGGTGTACTGCTATTTGCGTCTGAGATTTGTCCATATCCTTGGCTGCCTTCTCTGCTCTCTTCTTCTCCCTGCTGGCCAGAACTTTCTCCCTGGATTTCTGGGCCCTTTCAGCGCAATCCTTGGGTCGTGTCTTCAGGGTCATATCATCCACGGCCGCCTGTTTACGGGCTGATCTCGAAATGCATCGTTCCATGCAGC


Search Again