CR00355

CRIMIC CR00355

Gene Top1

CG6146

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p2 short band OKOrder from Bellen Lab

Images

Construct Sequences

sgRNA sequence
TCTAGACAAAGAAAAGAGGGTGG

Amplicon 5' Amplicon 3'
GATCAGTGCGCATTGCTCAGATTCGTCCGAGCTCAAGGCAACATGCCGCCATGTGTTTTTGGCTGCGAGAAGTTTTCGGATGTCACTGACCTACATTTCCGAAAGTCACACACTCAGCGGACGGCCGACGCACAGTGGCTGCCGCAAGTTATTGTCCGCCTGTGGCTCGTCGCACAGTGGCGTTCGTTTGGGCGACAACTGTTGGCGCTCACTGTGCGGCGAGCGCCATTCGCCACGAAACGCATGCGTCGCTCCAGCCCCTGCTCCCCCCGCTCACCATGTACAGTTGCAATGAAAAAAAAAACAGCTGAGCAGGCCGAATAATGCGCATTTGAGGTTAGGTTCGAACGCGGCTGATTGACTGCTGCTTTGCGTAATGCTATAGATAAATCGGAGATATACCAAACCAAATGTTGCGCTCTTGGGTGGCATTGCGTCCATTCGAAAAGCAGAGTGTCTGCCTGGTGCTCGGACAGCGTATGTTGGCCGTAGCCACCGTTGCGGGCAAACGGAGAAGAGTGCGACGGAAGAGCGTCCAGGAAGAGCAAATTCGATGGTGCGACT GACAAAGAAAAGAGGGTGGACCCAATTGCTCTTGATTACTGCTAGCAATGGCTAGCCTATGCCTATGCCTAGCCTATAATTTCTATAAAAACTAGAATAGTAATAGTACCCATTTATATTAGAAAGTTAATTGATAATATTTCTTCGACAATCGGGGGTGCTTAACATTTTGAACTCAACTATAGAAGGTTCAGTCTTAAAGCTCCTATTATCCGCGCCTGTATATGAAGCACTAACCCGAGTCATCCTACATTCCAGGTGGGAGGAGGAGAAGCGTGCCGATGGCGTCAAATGGTCAACGCTGGAGCACAAGGGACCCGTGTTTGCACCGCGATACGAACGGGTGCCACGCAATGTACGGTTCTACTACGATGGCAAGCCGTTGGAGCTCTCTGAGGAAACGGAGGAGGCAGCCACGTTCTATGCCAAGATGCTGAACCACGACTACTGCACCAAGGAAGTGTTCAATAACAACTTCTTCAAGGACTTCCGCAAGTCCATGACGCCCAGAGAGAGGGAGATTATCAAGGATTTCCGCAAGTGCAACTTCCAGGAGATGTTCAACTACTTCCAAGCGGAGTCCGAAAAGCGCAAGGCAGCCAGCAAGGAGGAGAAGCTGATCAAGAAGAACGAAAACGAGGCGCTGATGAAGGAATTCGGATTCTGCATGATTGATGGGCACAAGGAGAAGATCGGTAACTTCCGCCTGGAGCCGCCAGGCCTGTTCCGCGGTCGTGGCGAGCATCCCAAAATGGGCATGATCAAGCGGCGCATCCAAGCCAGCGATGTGTCCATTAACTGTGGCAAAGATTCAAAGGTGCCTTCACCGCCGCCCGGATCTCGCTGGAAGGAGGTGCGCCACGACAACACGGTCACCTGGCTGGCCTCCTGGATCGAGAATGTGCAGGGACAGGTCAAGTACATCATGTTGAATCCCTCCTCGAAACTCAAGGGCGAGAAGGATCACATTAAGTACGAGACGGCGCGACGCCTGGACAAGGTAATCGATAAGATACGTGCCACCTATCGCGACGAGTGGAAGTCCAAGGAGATGAGGGTTCGCCAGCGAGCGGTGGCCCTTTACTTCATCGACAAACTGGCGC


Search Again