CR00354

CRIMIC CR00354

Gene sax

CG1891

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p2 OK OK78897

Images

Construct Sequences

sgRNA sequence
TAGCTCCCGCTTCCGCCCAAAGG

Amplicon 5' Amplicon 3'
CGCAGTGGACATGAAAACCCTAACTAAGCAAATGTTTTGTTATATTCCATGACACCGGGTAGGTAAATCCGTTAATTTCACTCAGGAAAACAACTTAATGGCACGAAAACTCCTCCACTGAAGATCTCCTGCTTCTCCACTTACCTAAATTGAACACAATTATGCTTTGTGAACACAACGGCACTGAATAAAATAATTGTCTGTTAAATGGGCTCCTTTGCCAAAGACTCTTTGATGGGAGTTCGAGTTTGACGTTCTAGAAACTTTTCCGCTGACCGGCTGCTCGTGTTGGTGTGCGTGTTGTGCTTTGGTATTTTTACGCAGGGGATTTGGGAAATTTGAAGACCCGGTATTTTATGTGAAATATGTTATGTGCAGATGTGGGCCCTGGTCACACTGCCCGCTAGAAGTATATCGATAGGTTCCGATAGGCTCGGACAAATAACATTTCTAGCAATGGAGTCCAATATATATTTAGTTTTTCTATTGACGTTTCTGCTGTACAATAATGCCAGAGGTGGGCATCAATTAGTGTTAATCAATTACCAAGTGCTTGGTGAAGAGAGTGCGCAAGAGAAATTTCGATTTTATGGGGTTTTAGAGCCACATATAATGCCTTGAAAAGTCACTGAGTGTTTTGGGTTTGTTTTCATATGCTGCGGTTCTGGCCAATTGCGTTGCGTATTTGGCCAGGCCAAGGCGAAAAAAGTGCCCTCGGAATGCTGATTGGTGAAAGAAGCACCTGATGGATCCCACAGAATGTATTATATAAACGGATGTCGTGGGCGTTTGCAGCATAAGTGCATTTTCTCAATGATTTACCCACGCACACCACCGTTCTGTGTGTGTATACAGAACTTGCTGGGGCGCCTGTGTGCATGTGTGTGTGTGTGTTAGTGCTGGTGGCGTTTGTGTTGGTTGGGCCGTCCATGTGTGTACATATGTATATGCTATGTGCATATGGTTTAATGTGCATTTGTTATGTTTCAGCCGAAATCAGCGATCATCTGCGGGAGGACATACCGGACTTAGACATGGAGCTCTCCTCCGCCTCATCCGCCCATCTCAATGGCAAGGAGCTACCGGCCGTGCCACAGAACTCGGTGCAGACGCATCCCAGGTGATTATATCT TTGTAGCTCCCGCTTCCGCCCAAAGGCTTTGTATTGCTAATCTCATTTCCCTCCTAATTGCCATGCTGCTAATCCTTAATTAGGAGACACATTAAGAGTAAGCGCCGCATGAAGAGAAGGTAAAACCTACACGACTCATGAACTAAAACATCATAAACTGGTTAACTTTTAGTTAAAATTTTGAAAATATTCATAATTTTACTTAAAAAACCCCATTTTTTTTAAATATTTTATAGTATATTATACTTTTATACCCAAATGTTAACAATTAAAAGCTGCCCGTTTGCGTAACCGATTCTTCTTCAATCTTATTAAACTCTCTCTTTTTTTTATCAGATACAAATGCTACTCCTGCGAGCCGCCCTGTCGGGATCCCTATGAGTTTACCCACACCTGCCAGAATGCGATTCAGGTGAATACTCCACCTTAAACTTGATTAAAACTTAAATGTAACTTAATTTCCGAACTTCAACAGTGCTGGAAGTCGCGCACACGCGATGCCGATGGTCAGGTGCAGGAGTCACGCGGCTGCAGCACCTCGCCGGATCAACTGCCCATGATCTGCAGCCAGAACTCCTTGAAGATCAACGGGCC


Search Again