CR00352

CRIMIC CR00352

Gene LamC

CG10119

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p2 short band OK79242

Images

Construct Sequences

sgRNA sequence
CGAGACACAGGCAGAAAATGGGG

Amplicon 5' Amplicon 3'
CACCCGCCTTTTAGCCAAACTCTTAACTTCGTTAACGCATTGCAAAACGCACAAACAACAAATTGTGGCTATTATGAATTGAAAAAGCTTTGGGCCTCATCGCGCAGTAAATACCAAAAATAAATATGATAACGCAAACGACGCGAAACGGAAATCTCGCAAGTGGAAAAGCTAAGCAACCCAACTTTTGTTGACTTCCCACCAGAAACTGGTATTACAAATGGATCTGTAACTGAGTGCCATATGACATCATAGTCTTGTAACCTTCATTGAGATTTACGGCGGTATTTCGATTCTTCCTTTTTGATTTTCATTGGGTTTCTTTTGGTTTACTACTCACACATTAGCTGAGAACTAAACATTTGCATAAAAATGCCTAGAGAATTCTGGAAGTGTAAATGCAAAAAATAAACAACAGCGAAAGAGTCGAGAGAGTTTCCCATGTGCTTGGCTTTCAAAATGTGCTTTTGGCATGACATCATCGGCCTCGCTCGCTCTCAGTCTGCCCCGTTCTCTGTCTGTCTCTGTCACTCCCTACATATAAAAAAAAAACAACCATGGAAACTGAAGTTTGTATCTTACTAAAACTCTTTTCTTCTTACGAATAGCATGAAATATGAAAATTAAATATATTGCCTTTATAAATAAAACAATTTGTTATTGTTTTCGCTACATAACTACATAGCTGGAATTGAACTTCTAGGTCAACTGTACCTAAGAAATAAATATAAAATTCGCTTATTTCAATACAAAATACAACAAAAAAGTAAAAAAAAAAAAACAATTTGATAAAAAGTAGTGCATTTCTAGAAATCTCGACTGACTGTACTTTTACTTTACAAATCGAAGAAATTTCGCTGCTTTTCGTGCTGTGCATTATTGATTCCACATTTTCTTGACAAGGCTCCCAAAGTTGCCCCCATTTTCTGCCTGTGTCTCGCG TGTCTCGCGCTCCAGTGGCCCGGCATGGGTACATATGTACATATGACATCACTGGCTGATAATACGCTGTTACCAATTCCGAGCCCAAACCTGAACCCGCCGTCTTGGAGCTTTACCTGGGCTTCAAGTCGTCGTTCTCCTCCCACAGACGCTTGATATCGATCTCAAGCTTGGCCTTCTCTTTGGCGGTCTCATCGAGCAGCTTGCGAGCGGCGGCCAGCTCCTTCTCATAGACCGCCTTCAGATTAGAGGTCTCCCTGTTGACGGTATCCTGGGCGAGATTCAGTTCCTGGGTGAGCCGGCTGTTCTCGTTCTCCAGGTTGCGCATGCGATCGATGTAGCAGGCCAGGCGATCGTTCAAATGCTGCAGTTCCTCCTTCTCCTGCTGCCGGCTGGTGCGCGTGGGCGAGGTGGGTGAGGTGGCGCCCACCCTTGACGAGGTGGATGCCCCGCCCACCGGCGTGGAGGTGGAGGCGCGCGAAACGCGTGTGTTCAATGTGACGCGGCGTGCTGACATTTTTGCAATGTGTTTTCTTTTCTTTTTGCGAGGTGCGAGTTGCTAAGTTAAGTACGTAATCCTCTCAAGTCACTGTCAATATTTTTGATTCTGAATTTTTTTTGCTTGGACGTCCGCCTGCTTTGACGACTAAAAATTGACTGAAACTTTGACTCGAAACGAACGGCTATCATCGACAAAATTAGTCGTCGTCGGCGGCGGCGGTCATAAAAAACCAAATACAACACGAATGCGGCGCTGCTCTCTCTATTTTTTCCGCTCTCACCTTTTGGCTTTAGTATTATTGTTGTTTCGCCTTCCACCATATTCGCTTTCCCATTCGCATATGTAAGAGTTGTTGTGCTTTCCTATGTACAGCTGTTTGTGCCGCTGGAACTCTAAATAGAAATCGAACAACTAACAAACACACCAACTGGTCCCAAAAACGAGTTCTTTACATTTTGTTTTACTTCTCTGGAAAATCTTTAAAAATCTTGAAAATCGTGTTTTAATATAAAATGAAAGAAATTTGTAAGAAACACATGTTTTTGTTAAGTTCTAGCATTAAACTTACAGTGTTCTTTTTAAAGAAGCTGCACTGTACCTTTAGGCGG


Search Again