CR00351

CRIMIC CR00351

Gene CG16758

CG16758

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p2 OK OK78896

Images

Construct Sequences

sgRNA sequence
AGAACCAGGTGAATTCTTTATGG

Amplicon 5' Amplicon 3'
GGTCCTGGATCATATCGGCCAATGAGCCTAGCCCAGAGCCGCAGATGATGCCGATCTTGGGGCGCATGCCGGACCCCTTGGTAATGAAGTCGGCGATCTCCTCGATGACCTCATAGGGATACCTGTCGAAAACCAAAATTAGTTTTACATCTTGTTTGGGTGAGTATTGCAGGGTGATCTTTGAACTAATAAAAGTGTAAACAATATACGAGTGAACTGCGATAAATTTGGGTGGGTACATGTTAACAGGCCAGAGATCCTTTTTATCTACTCGCCACGATGGTAAACAATGAAATGAAGAATGGAATTCCCAGAGGGAACAAAAAAGATACATTTACCAATTGATGAAGTTCCACACACAGGAATATAATTAGATTCAATTCACCAATCGAAGTTTTATCAAAACAAATAATTCATTTATGTACAATCAGTTCGATGATATGATAAGAAAACAACACAAATATTATACAGTGAGAACTCAGAAGACTAAAAACTTTAGAGATCATGGACACATGAATTCATTATCGAATTACATAGATATTCTTAAAAAGGACAAAAACAAAAATCGAATTTATGGATAAGAATATCTTTGAAGAACTGAAAGTGTCTTCTTGAAGATTCTTATCAGCCTTATGCCAATCACAGTACTGTGAATACATGTATTTTAATAATAAAGTAAATGACAATTGAACACAGAGAAACAGAACTCAGAAGAATTGGTCTACAAACGTGTCTTCGTTGAGAACCCGAAGGGCTCTTAGCTCTTCGTGCGTAAGCTCGCATTGGATTTTTCCATTTCCGCTGCAATTGTGGAAAAGATTTGTTGCTGAGTAGGTTGGCAAAGGTTTGTGATAAACGGATATGAAGGCATCCAGATAAGGACCCCCTATCATTTATGGTTTTTCTTGGCAATCAAAAGAATGTGGTAACATTGTCATGACTCGCTTGCTATTATCGAGTAACTTGAAAACAGCAATTAAGTGCTATTAGAGCCATAAAGAATTCACCTGGTTCTGGG TTGCTCGAACTTGAACTGCAAGTCGAGTTATGTTAAGATGTTGTTACCAAAACTGAACTCACGACCTCCCACGTGTTTGTTTTCGGATCAGTTCAAATGATTTGATAAGCCGGGCATGAGACGATGCTAAGCATTATCAGTATTACATGGAAAAAACAAAAGCTGGCCTTCGAACAGTAAACATAAAGTGCGTCATTAAGACGGGAACATATAATCACGCATAACTTGCACTAATTGGGAACTTTATTCACAATTCCTTAATAAATTGGTCTTTCAGTAGCCAGACATTTATGGAAATTTGATCTAAACACGCGACGCGGCTTTTTCGCCGCTTCATCAATATTCAGCATTGTGATTCCATCGGAATGGAAACTAGTTTCGAAATTAATCAATGCGGCAACATGTTTTAGTTGCGTTCTTTATCGAACCATTGGCCAATTACCCGTATCTGAGGCAAAGATTACGAAGTGGAGGCCTATGTCAAGATCAGGGAACACACCCGTTTTGCGCAGCCAATCAGCGGGAGCCGATTTCCCAGTTAACTTGGCCATTAAACACTTACATAAGCAGTTGGCAATCTTGGCTTTTTTATCAGCAAAATGTTTGGTACACAGAGAAAATATAAATAATTAAAACAAGGCACTCTGAAGAGCGCCCAGCTGCTTAAAACGTGCTCTAAAAATATTAACTCTAAAATAATGAGGAAATTAGTTAATTAAAAAAATATTTCCTGAACACTTGACTCTTTCGAATACATATACGTTTTCTACTGTGTATTTCTACCTAGGCGAAACCACTCCATATAATCATATGCAGATTAAAGATTCTTCGAATGGGATTTTAATGAGTAGCCAGCGTCGACT


Search Again