CR00348

CRIMIC CR00348

Gene Plod

CG6199

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p2 short band no band79241

Images

Construct Sequences

sgRNA sequence
CCAGCAAGACACATGGAAAGGGG

Amplicon 5' Amplicon 3'
CCTGGGACGCAAGATCACTTTCTTTTGCATGGCTCAAGGTGAGAGTTAGTTAGATGAAGTTACCAAGTCACCAAACATTGACATACTGACATTTTTGGATATTAGGCAATCCCCGACCGACCATTACCTGGTTTAAGGATGGCGCAGAGCTCTACCAACACCGATTCTTTCAGGTAACTTACGAAATTAATACTTTAAATATATATATAAAATTTTTACATTTACAGGTACACGAATCTCACATAGAAGCGAATATTGTTAAATCTAAAATGGAAATCGATCCAACCACTCAAATGGATGCTGGTAAGTTCGACAAATGATCATTAAATGTATACTTAGATTATATGTATATATTATTACCAATCTTTTCAGGTTTCTACGAGTGTCAAGCGGACAATATCTATGCCATCGATCGTCGAGGTTTTCGCACGGACTACGTTATGGTTAACTTTTGAGAAAAGCCCACTTTTCAGCCATTACAAAATCCTTTGACACAGTAAAGCTGAGATGTAACTATAAACTACAATGCTTTCGATACAATTAAATAAAAATATTTAAAAATACATTTTTGCGTTTCGGATTATGGAAATTTAAAGTCTATTTCAATCCGACCTTTCTGCTTCCTCGTGTGCATTTATGTGAGTATCTGTGAGTGGCAAAGTACATAGGTGTGTGTGCGCACAAAGCCGACAAATTGACTCAATTACCCAATTCAAGTGATTTTTTTGCATTTATTTTATTAAAATGTGTGAAAGCAAACCAAACAAACCGAGGCTTTTTGGTTCTAAAGTGTTGAGTGCTCTATAGCCTTCAAAAAGGCACAGTGGAACAAAGAAACACAAACATGTTTTTTAAAATAGAATAACAAGTTTACAAATCGATGTTCTTCTAGCACTAAGTAGTAATAAAATCTAAATCCATCTCATTGTATCTACAAATTGTTTTGACGAACCAAAATGTATAAACTATTATCTGCATATTCGGGAAAATATTTGAATACAACAATCCAGTTCCTTTAACTACTTTCCCTGAAAGCGTACTATCGTGCCATTGCCACTGTAAACTAGACCGAATCCCAGCAA GGTGCCATGGCCTACGATGGCGAGCGATATCAGCAAGCTACCAAATCAAATCTAGCTAGGGAATTGAGTGAAATGTGGAAATGCGGCGATGAGAAATGTGAATCCAGAATAAAAAAGCCGCGAGCGGCGGCGAATTTCGAGAGCACACCAAACGGTTTAAATCCGCCGGACAATTGTGGCAAATTAGATGAGCCGAGCAGAGTGGTGCAGACTCTGGCCGAGTGGATCAGTCACCGATCAAACGAGATTCGCACAGCAACGCCAGCAGCAGCAGCAGCAGCAGGAAAATATAGCGACAGTGATCATCTCCGTCAGCAGCATTATCCATTATCCGGAGAGTCATGCAGGTTAAGTGCCTGATCGTCTGTCTCGCTTTGGGGCTATTAATGCTGGCCACGCCCGTTTGCGAAGCGCGCCGAGGGCGTGGACGTGGACGAACCAAGTCCAGGGTGCAGATCGGATTGCCAATTACCGGAAAATATCGCGATCCGGAGTCCGATCAGTACTACAATAATAATAATGTAAGTGAAGGTGAAATTTGCTGAAGTTCCCTATTAACTATTGCCTGTTTTAGGGCGCCAAAATCCTACAAGCCTCGCACTTCGA


Search Again