CR00347

CRIMIC CR00347

Gene Lgr3

CG31096

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p2 OK OK78895

Images

Construct Sequences

sgRNA sequence
CAAGTGAGGAATGTGAGGCCTGG

Amplicon 5' Amplicon 3'
CAACAACGTTAGCCACCTGCCGCACGGTGTCTTCCTGGGGCTGCACAGCCTCCAGTGGCTGTTCTTGGTCAATAACCATCTGCACCACCTGCCCGTGGAGCAACTGCGATTCTTTAGACGATTGGAGTGGCTGGTGCTGAGCAGGAATCGTCTCACACTGCGAAATGTGCAGCTGCCGAAAATCCCGACGCTCTACGAAGTGTGAGTAAATCGAATTGGGCGCTCGCTCTTCTATTTGCTAGATTAAAAACTGAAAGGACTAGCAGCTACGCTGATGTATTCAAGCGTGAAATGCTGCTAAAAGCTGCTGGTGCAGTGGTGCTCATTGGGTTACTCGAGTATTGGGTGTCCTGGCGGATAGCTGGTTGGCCCTAAGCCGAGCCAACTGCTCGGTGATTCTGTTAAGGACTCACACAATGTTGTCAACGTGGTTGAACTCACTTGGCGACCAAAGTGTCCGTTTGATGTCCTTTAGTGGTTTTGAAGTTCACGATTTAAGGTTGCAACATTGAAGTTTTTAGCTCTCTTCAAAGGCTTACATCTACACATTACCAAGAAACATTTTTATATAAATTCTTAAAGAGAATCCTAGTTGCCCTGCATCAACTTTGATTATCTTCCGTCTGCCCAGGCCTCACATTCCTCACT ACACACAATGAGCTTAGGGCTGTCTTTGAACACAGATCCGAAAATATACATATATAAACCAAACTAGGCCTACAGCTTAGCCAGATTGTTGGATGCCTGCATAAATATCTCTTTACTTTTACAGTTATTTGGATTTCAATCGAATCGAATACATTGGCGAGGAAACTTTTTCCCAATTGGATAATTTACATTTGCTGTAAGTAAAACAATCAACATTCACCCACTCGTCCCAAAACAAAAAAAAAAACAAAAAACATGGCAAAAGATGCCAGCAAGTGTCGAAAAGTCTATTGAAATATGTTGTACTTAGATTTTATGGGGCGTATGCGTAATTTTTACTCTTCGTTGCATTTCGCTTTCGTTCGTTTTCACTCGGATCTTTTTTTTACTTGTTTATTTCGAGAGATTTATGTGGGTTACATTGTTGCTGAGGCAGTAGAAAAGATGGATGGAGCATTGCGTATACGCACTGTTGACATGACACTGAGGTGGATATTCGATACTTCGACACCTTCTTACCGGC


Search Again