CR00346

CRIMIC CR00346

Gene CG5938

CG5938

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p2 short band short bandOrder from Bellen Lab

Images

Construct Sequences

sgRNA sequence
ATGGGGTCAAATAGCAGGGCAGG

Amplicon 5' Amplicon 3'
AGGCCAGACGTCATAATCGCATCACTGGGAAGCGCGACAGACGTCGACATTTTATGGCGGAAGCAGCAGTGTCAATCTGCGATTGAAGGACAGCTCTAAAGGAACACCCAGGATCCCCGCCAGCGACGGCAGACAGCAACATGTTTTGACCTCCCACTCGGTACAGCTGGAGCGTCCGCTGCTCTTCTCTGTTCCCCTTGGTCACCTAGTCATCCGTTCTCACCACATCGCCCCATCAGCCCTCCATAATAAGCACGGCCAACCATGTCCTTCTCCGACTTCGACGCCATCTACGAGGATGAGCAGCTGGACGAGCTGGAGCACTTCCAGGACCAAACGGTGGCGCCGGTCCAGGAGCCCATCATCATACGCGGCGCGGGCAACATGACGGTGTAAGTGGGTCTATGCACTGAGTGATAAGCGGGAAAACAGATAGCTGGAGTAGTTAAGGGTATAACCTCATTCAGTAAGACAACACCATTATCAGCACAATTGAAGGCAAAGTAAGAACTTTTAACGCCATAGTAATCTTTAGTGAAACAATGAACTACGTATTTCATTTTATAAAGGGTAGGTTGCCACAGAGATCCTTTAGATTATCTGCATATAGAATATCTATCTTATAGAATATTATACAGATACAGAAATGATAGGTGTATGCTTTCAGCATTGTCTGTAACATTGTCTGCATGAACGAACCTATTTAAAAAGTAGTTCAAGGTTAACGCCACCCAATTTCGATCTAGGCCCTGCCCTGCTATTTGACCCCAT CCATTTTTGGGGGAGAACGCCTTTGCTGCCCAGCAGTCAATTACAGGAAGGTTGCATAAGAAATGAGTCAGGGCAGAATAATTGCACTTGCACTGCACACGAATTGTAACTTTTTCACACGCACACTTGCAGATTTGGGCTAAGCAACCGCTTCAACGCGGAGTTTCCCTGCGGTCTGCTGTCGCGCGTGGCTCCCGAGGAGTTCAAGGCGACGGTGGGCCGGATCAACGGAGTGCTGAAGAAATCCCTGCCCGTCAACGTCAAATGGCTCTTCTGCGGCTGCGTCTGCTGTTGCTGCACGCTCGGTTGTTCCCTCTGGCCCGTCATCTGTCTCAGCAAACGCGTAAGCCTTAGATTAATCTAGAAAATCGGTCATGAGCCTAGCCTAAATCCTTTTTCAATTTTGTAGACACAACTCACACTGGACAAGCTGTTCGAATGGGAGAACAATCATCTATATCATAAGCTGGGCCTGCACTGGCGACTGCATAAGCAACAATGTGATTCCAATTCCATGATGGAGTATGTTATTTTAATTGAATTTATACCCAAAACGCCCATCTACCGGCCCGACTAAGTGCCGTCGTGGAGGAGGAGGGGCGTGGTATCACAGGGTC


Search Again