CR00344

CRIMIC CR00344

Gene RpS5a

CG8922

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p0 short band OK80581

Images

Construct Sequences

sgRNA sequence
GTTAATCCGAGTGCCGAACGTGG

Amplicon 5' Amplicon 3'
TTAACGGTTGGACTTGGCGACACGCTCCAACTCATCCTTCTTCTTGATGGCGTACGAGTTGGAAGATCCCTGGAAATACATTTAAACACAAGTTATTAGTATTGGCTATCAATGTTTTTCTAGATCTTTTATATGTTAATTGCGCTGTTATGTTACTGTTACTGCATTGTATGGATTCATCGCTTCTAAATAAATAAATATAAAAAAACAAGTCCCTAACTTATTTAAAGCTAGTGTTCCTTTACGTTTCTCATGTGCATTGAACTAAGCAATATTACAAGCACAAGGATAATAAAGGATGGAAATTAATCTGGTCCAAAAGCGAGACTACATAATTAAACCACCATGCAGAATTAGATTGGACCTATTATTAAGCTCTATATACCAACTCTTAAATAGTTTGCTAATGTTCTTTTACGTTTCTCGTGTGCATTAGACTGATATTGTCACAAGCACAAGGATAATAAAGGATGGTGATTGTTCTGGTCCAAAAGCGAGACTACATAATTAAACCACTATGCAGAATTAGATTGGACCCCCGCTATCCTAATCGAATCAGTTCCTAAATGCTAATTCATAAAAGTGTTCTTTTACGTTTCTCGTGTGCATAGGACAGTTAAGTGGTCACTAGCACAAGGATAATAAGAGATTTGGAGTTTGATCTGGTCCAAAAGCGAGACTACATAAATAAACCATGATGCAGAATTAGATTGGACTAGTTGAAATGACTAGCTGTGTCACTAGAAGGAAGAAAAGAGCTATTTCGAAGCTCAATTCTTGGGTTAATCCGAGTGCCG ATCTGGTCTACAAGCGAGGCCAGGCATTTTGGTAGTACAATGCCAAGCATTAGAGTAGACCACCCCATTCCCACTTTGATCTCGCCACAAGCCCAATTTACCCACCTTAGCAGCGTTGATCAGCTCATCAGCCAGGCACTCGGCGATGGTCTTGATGTTCCTGAAGGCAGCCTCACGAGCTCCAGTGCACAGCAGCCAGATAGCCTAAAGGAAATATACGGAAAAAAATTAATTAAGTAACTTTATGAACGCAATCACAGCAGCGTAAGAATTTGGGGTTCTTATCGTTAGTAAAATGAAAGTGTGTTATGCAATTGATAATGTCTCTTCGTTTCATACGCCAAATGTCGGCTATACTACACATTATGACGCTACGGATATTAGATAGATTTTCGTTCTGGCCAAGTGTTATAAGCAAGCAGTCTCTAAACGAACCACAAGCCATTGCTACCGGCCACCGTGAGCACATGCATCTGGAAGGCAAATCTTCAGAAGAAACCCACCTGGTTGACGCGACGCAGGGGCGACACATCGACGGCCTGGCGACGGACGGTACCGGCACGTCCAATACGGGTGGAGTCCTCACGGGGTCCCGAGTTGATGATG


Search Again