CR00341

CRIMIC CR00341

Gene Surf4

CG6202

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p0 OK OK78894

Images

Construct Sequences

sgRNA sequence
AGGTCGAGTTCCGTAATAGTTGG

Amplicon 5' Amplicon 3'
AACTTGCCATACGCTCAGCTCAAAGCGGATCAAAGTGATGAACATGAAGGCCAGCAGGATGCGGCCCGCCAGCTGCATGAAGTTCTTGGGCTTGTTTTCGCCCATCGATGGCACGCCGGCAAACAGGCTGCGCCCCTCTATCCTGGCTTCCGCCAGGACGAGCAGTAGGGCTCCGATGAGTGCAAAGTTTCGCAGTAAGAACTGGAAGTCCCACAGAATGGAGTAGGCAACGGTCTGCAAACAGAGGATCGGGTTAACGTCAAGGCTTTTGCTTCTGGCTGATATAAATGCAGACTCACCTGCAACACCACAATGAAGAAAAGCAGTCCCACCGCTATGTCGACCTTAAATCTGGCCATCACCATGCCGCAGCCGCCCAGTTGGCCCAACAGGTTGACGAGCACAAAGACGGTGGCCAGGAACTTGCCGCAGCCCCAGCTCATGTCCATGTACTCCCGCTGCTCGTTCCATTGGATGTACATGCGCAGGCCGTCCTCGAAGAACGTGGCGATGAGGCACAAACGGGCCACTGTGGGCAGCACATTTTTGCCGCGCTTGATGACCTGCAAAAATGAGTGTTCGATTGGTTCTGGTTGAGTTGAGAGCAATTGGGATGGGTGCTGATATGGTGATAAGGGGACTACTGACAAGGTGATAAGGGATTTAAATATACAATGCCGTTGAGCGTGGCTTGCGCGTAGTCGCTAGAAATCGCCCGCTGGCTGTGACGTGTCTCTAAACGCTAGTATCTCTCGATTGCTATCTGCCAGCTAACGGGTTTTGGCCCGGCTGTCAATGTAACTTCATACATGTATGTATGTAAATCGCGAGCAAGTTCACCTGGCTTTCT TTACGGAACTCGACCTGGCCGCTGGCGTCCAGCTGCCCGCTATTTCTTTTTCAACACTTTCACTTGCGGAGACAGCTCTCTCGCACACACACACAGACACATACGCATCAGCACACAGGTAGAAAATAAGCAGCGAGAGAGAGAGTTTTCCCTGCGGCAGACGCAACAACTGTCAATTGCGGTACTGGAGTACAAGGCAAACCCATCATCTGGGTTGCACCCAGATTCTTATTGGAAGCAAATGCCCAGCACGTTGCCCCCATGTCAGCGGATCGTGATTATATGCAGCCAAGACCCTCGAACTTTGCCGCGTTTGGGTGACGTTGGCAGTTTTCCCAGTTTGCAGCTGCCAGGGCTTCCCCGCAAACGCCATTTGGGGCGCATCGGGAAGACGCTTCCTGCGGTGGATATGGAGTCCTGGTGGACTTCTTTTTGGCAGTGGAACCTAATATATCTTACCTGTTCCGCCACATCCTCCGTTTTCGCTATGTACTCGTTGGGTATGCTCATGTTGGCTGCTTTGGGCTGATCCGATCTCTCACTTTGGGGCAATCGTCTGTGGAGACACTTTGGCAATTCGTTTCTGACTTCTTGGGCGTCGCGTCGCTCTCCAAATTGTTGTTAAGTTACCAAAAAATCATGAATTAAAAGGCAGGAACTTAAAAACACACACGCACGACAAAGTATAGCCGTGATGGGGCCTA


Search Again