CR00339

CRIMIC CR00339

Gene RnrS

CG8975

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p0 OK OK78893

Images

Construct Sequences

sgRNA sequence
AACCACGTTGAGTACGTGACCGG

Amplicon 5' Amplicon 3'
ATGATGCGTTCCCCGAAGTTGGCCGATTTGGAGGAGATCCAGGACAGGGCCCAGTCTGCCTTGCGCTTCACAGCCGGCATCGTTTCGATAGCGTTAAACAGGTACTCTCGCTGGTGTGGATCACGGATGTAAGTGTCGATCAAAACACTGTACATCTCCGAGTGCACGTTCTCCATGGCGATCTGAAAGCCGTAGAAGCAACGTGCCTCCGTGATCTGCACCTCCTGACTGAAGCGCTCCACCAGGTTCTCGTTTACGATGCCGTCGGAGGCGGCGAAGAAGGCAAGCACGTGCGAGATGAAATGGCGCTCGTCGTCCTTCAGGCGGTGCCAATCAGTAAGGTCCTTGGACAAATCCACCTCCTCGACAGTCCAGAAAGAAGCCTCAGCCTGCACATTAAAAAAAAAAGTTACAATTTTAAAAGAGATAATTACTGTATAAATTTATTATTTTTCATTTTCCACTTTAACAAGTTTTCAAGAAATGTCATCGTGCACAACGAGCTTATCAATTAAAATGCAATTAAAATGTAAACAAAGTTACTACAAAGCAATTAAAAGCGGCGGGGAAATGTAATTGGCTACATAAAATGGTATAGTATGTGATCGTTATGTGCTGCATTTCCCGCCAAAAACGAAGGCTATTGTTGACATTGAGTAAACCGTGATGCAGTGAATCAGCGGAAAGGGAGGGTCGAGAAATGTGGGAGGGGGTTGTTTAACCAAACGAAGCTATCATAAAGTCTGATTCGTGTAATCAACCACGTTGA GGCGCGCTTTATCTCGAAATGCCCGCCCTTTTGATATTTTGCCGCCCAAAAAATAGATTTTCACCACCAATGCAAATGGACAGTGTTTTGCTATATGTATGGTATACACACCTTCTTGTACATCTGCCAGATGTCGTGGTACTGGATGGGAAAGATGACGAAGCGTCGGGGATTCTCGCGCAGAAGGGGCTCCAGCGACGGGTCGAAGGGGGTTACGGACTTCTCCATGAGGGAATTGGCAGACTTGCCGATGCCATTCACGGTGGAGGACTCCTTGGCCAACTGTCCGTTTGCCTCGTGTCCAATGGACATCTTGCGAACGTTGTTGGTGCTATCCGTCAGAATCTTCTTGCTCGGGCTCTGTTAACAACGAAAAACAAAGAAGGCCAACTAAAGCATGAGTATTTTTCCGCTGCGTAGCACTTTTCCCTAGGGAAATCAACACAAGCGCACTGATCGCGGTATTACGTCTATGTATAGCTGTGAACTTTATTTGCGTGTCGATTACCTTAAGCGAGAACTTCTCCATGTTGTCAGCAATGTTTTCCTTGGACGCCATTTGAGATGTTTTTGAATGGATTATTATTAGCAGGTAGGGGCGC


Search Again