CR00338

CRIMIC CR00338

Gene ktub

CG9398

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p0 OK OK78892

Images

Construct Sequences

sgRNA sequence
CCATGTGAACCTGGAACAGCTGG

Amplicon 5' Amplicon 3'
CACGTGCATGAACAGAACGGGTTTGACCGCCGGCCCGACGAGACGGATTTCCCTATCGCGCCGTGACTTCGATATCACGGAACCTTATCAACTCGGGTACTCGAAGATGTGGCCACTGCCATAAATCTCGTCACAGTGATTCCAGTGCCAGGAGAGGTGGTGGTCAGACGCCTTAGCACCAAAAAAACCAGAACACAGTTCCAATTCGTGCGCCGTCGAGGGCAGACATGTCGGTGTCCTGGTCGAAGACTTTCGCGGCATTCACCGTCGCCTGGCTCAGTGCCCTGTGCCTGCTGCCCGTGGAGACATTCTGTGACACCTCCTACTACGAGAAGTACTACGCGGCGCGGCGCTATGTGCCCCTCAAGCGAAATGCTCCGCTGGTCTTCAACTTTACCCTAACGCTGCCGGATGCGGATCAACTGGCGTCCTTCGAGCGGCCCGCCCTGGTGGGCAATCTGCCAGTGCTGGGCGCCTGGCAAGCGGGACGCGCTGTGCTCCTCAACCGCACTGCAATCCTGAATGTTTGGAGCGCCTCCGTGGAGATACCGCAAAACAGCAGCGTTGAGTATCGCTACTTTGCCGCCGCCGTTGGCCAGAGTGGAGCCGTGCAGATTCGCCGCTGGGAGTCGCATGTCCAGGCAAGGACCTTTAATACCACCAAGTTCAGTGGCAATCGCAGCGATGAGTTCGGACTCATTGGCAATGAGCGCCAGTTGTCGCGTGGCTGGCTTCAGGACTCGGGCAACATTCTGCAGTTGAAGCTCTTCCGCGAGGCTCTGAGCTTGGAGGAGCAACCGGAGGTGGGGCAGGAGAAGCTGCGTCTGCGTTTGCAACCAGTAGATCCAAAGACTCTAGCGCCCATCCTAAGTTCGGCACGTGCCAATGTGGAGTACGTGCGAATGGCGTACGGTGACAGTAAGCTGCGGGTGCAGCCGGAGTACGGAGTGCCCTACGCCACCGGTGACATCCTCATGT GGATCGAGTGGCCTATCTGGTGGAAGTTTATGCCGAACAACCGGATGAGGACCTGGTCCGTCTCCTAGGATACTCGCACCTGCTGCACACCTCGTTCTCCGGCACTGAAGGCGATGTGTCCATCGACCTTATTTCGCCGCTCTGGCAGCGCGTGGTGGGTCAACTGCGTATTGAGTACCTGCACATTCGGCCCATGGAGAAGGATGGCTTCGATCTGCGCACCAGCTTCGCCAACTACTGGCGCTCCAATTGGACAGCCCTGGAGATTGGCCATCGGGGATTGGGAAAATCTCTTACGGTCACCACGAATGCGGCTCCGCTTATCGAGAACACGGTGGCCACCATGCTGGCCTCCTCTGAATTGGGCGCTGATCTCGTGGAGTTTGATGTGCAGCTGACCAGCGACCTGGTGCCCATCATCCACCATGATTTTTCCATTCGCGTCTGCATTGACTCGAAGACCCCAACGAGCAAAGATGATTTGACCGAGGTGCTGCTAAAGGACATATCCTATGAGCAGCTCAAGGATCTGAAAACCTACCAGATCGTGGGCAACAAGATTGTCGAGTATCCGGCGCACAACAACGTGGAACCGCCGGAGCAGCGACTTTTCCCCACACTGCAGGACTTCTTTGAGCGGGTGAACCTGTCCACCGGATTCGACATCGAGATCAAGTGGCCACAGCAGAGGGCCGATGGACTGTTTGAGAGCGAACAGACGCTGGACAAGAACCTGTTCGCGGAT


Search Again