CR00334

CRIMIC CR00334

Gene csw

CG3954

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p0 OK OK78891

Images

Construct Sequences

sgRNA sequence
GCGGGCAAACTGCTTGCGCCAGG

Amplicon 5' Amplicon 3'
CCAGTCGAGCACTCAGTCAGTCAGTCAGTCAATCGCTCAGTTCGTTCAGTGGATGCGCCATCGATCGGTACATATGAATACATATCTACGAATAACAGTCGAACTAATTTAGTCATATATCCTAATAACCATCCACCTCTTTCTCTCCGCAGATGGTTTCATGGCAATCTTTCCGGAAAGGAAGCGGAAAAATTGATCCTGGAGCGGGGCAAGAATGGTTCGTTTCTCGTCCGTGAATCTCAGAGCAAGCCTGGCGACTTCGTCCTTTCCGTGCGCACGGACGACAAAGTAACGCATGTCATGATTCGATGGCAGGTATGTTGAATACGTAACCCCAACTAACCAGATTTTGTAGCCGCCCCTTGCCCCGCGCCCCTCGCAGGGTGCAAAATGCAAATGCAAATCGATGGCAGTGCAGCAACAAAGTCGCACTGGCCATAAAGTTCCTCATAGCGCGACCTTGGCTCTACAGTCGAGTCGTATGTACATATGTATGTGCACATAAACTCTACAGTTGAGCCTAACTAACAACGATGCTTGCTCGAGCGGAGTGGCAAGAATATTATAAAATCAATTGACAATAATATATTTAAACTCTTTCATCTTGAACGCATTTGGCTATCCGTAATTATCCGTTAACATTATCGAAGGCCTACTGTATAAACTCCGAAACATGCCTGCTTTGCCTTGGCG GAGCTTCAACCAGGTCAAGCAGTGCAGCAGTTCCAGTTTCAGCGTAATTCCCCTAAAACAATTTTTCCACTATTACTATAACTTTAGCCGTGAGCGCGGTTTCTGCGGTTTGCGGCTGCAATTATGCCATTTACATGTCTAGCTGGCCTTTTTCCCATTTGACATTGAAGTCACGTTTTCGATTTTATTAGCTAATCTCTCGACGCTCCATCGAACTCGGAGATAGAGACTCTCCACCACGTGTCCCCCCATTAGAATGCCACGATAACAATAGAGTGATTTCCTGATTGCAGGACAAGAAGTACGACGTCGGCGGCGGGGAATCCTTTGGCACCTTGTCGGAACTGATCGATCACTACAAGCGTAATCCCATGGTGGAGACGTGCGGAACCGTGGTGCATCTGCGACAGCCATTCAACGCCACACGAATCACGGCGGCCGGCATCAATGCCCGGGTGGAACAGCTGGTCAAGGTGAGTTCCCTCTCTCTGATAGCAGTGATTCTGGAGCGCACTAATCCCGAGGTGGCTTTCGATTCCAGGGAGGTTTCTGGGAGGAATTCGAATCGCTGCAACAGGACAGTCGGGACACATTCTCGCGCAACGAGGGCTACAAACAGGAGAACCGCCTCAAGAATCGCTACCGCAACATATTGCCATGTGAGTATAGAAATCCACTAAGATCCGTTAGGACTCCCAAAATCCTGACGGTTTAAAACAGTTATTTCTAACTAACTAACTAACATTAACTAACAAATTTCTAACCTATTTCCCTGTCCGCTTTCCAGACGACCACACGCGCGTCAAGCTGCTGGACGTGGAGCATAGCGTGGCCGGAGCCGAGTACATCAATGCCAACTACATACGGCTGCCCAC


Search Again