CR00332

CRIMIC CR00332

Gene Gk1

CG18374

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p0 short band short band79240

Images

Construct Sequences

sgRNA sequence
TGATATAGGCACGGCCGAGGTGG

Amplicon 5' Amplicon 3'
CTGGGAAACGCCGTAAGCTAGGGGAATGGTAAAGAGAGCAGCGCAGTAAACAACTAGGTAAAAATAATTGATAACATCTTACGACGTAACGATTCGAAAATTTTCCACAGCCGGCGACCCGTTTCAATGTCAACTCTAGTTAATACCACGAGACGCAGCATTGTGATCGCCATTCATCAGCAGCTACGCAGGATGTCCGTCCAAAAGAGGAAGGATCAAAGTGCGACCATTGCTGTGGGTCAGATGCGCTCTACCAGCGACAAGGCGGCTAATCTTAGCCAAGTGATAGAGCTAGTGGATAGGGCCAAGTCACAGAACGCCTGCATGCTCTTTCTGCCTGAGTGCTGTGACTTTGTGGGCGAGAGCCGGACCCAAACTATTGAGCTCTCCGAGGGCTTGGACGGCGAGTTAATGGCGCAGTACCGGGAATTGGCGAAGTGCAACAAAATTTGGATTTCCCTGGGTGGCGTGCACGAGCGGAACGATCAAAAAATCTTCAACGCTCATGTTTTGCTCAACGAGAAAGGGGAACTAGCAGCAGTATACAGAAAGCTGCACATGTTTGATGTTACGACTAAAGAGGTTCGCCTACGCGAATCAGATACAGTTACGCCGGGATACTGCCTTGAGCGCCCAGTGAGCACTCCAGTTGGCCAGATAGGGCTTCAGATTTGCTACGACCTGCGTTTTGCTGAGCCGGCGGTGCTGCTCAGGAAGCTGGGTGCCAATTTGTTAACATACCCATCCGCATTCACATACGCAACCGGTAAGGCGCACTGGGAAATCCTCCTGCGGGCCAGAGCCATAGAGACTCAATGCTTTGTGGTCGCTGCGGCTCAGATAGGTTGGCACAACCAGAAGCGACAGAGTTGGGGCCACAGCATGATCGTTAGCCCCTGGGGAAACGTACTGGCTGACTGCAGCGAGCAGGAGCTTGATATAGGCACGGCC GTGGACCTTTCCGTGCTTCAATCTCTGTATCAGACCATGCCCTGCTTCGAACATCGTCGAAACGACATCTACGCCTTAACAGCCTACAACCTTCGTAGCAAAGAACCAACCCAGGATCGACCATTTGCCACTAATATCGTGGACAAGCGCACAATTTTTTATGAGTCTGAGCACTGCTTTGCATTCACCAACCTGCGCTGTGTTGTAAAGGGTCACGTCCTTGTGTCCACTAAGCGAGTGACTCCGCGCCTTTGTGGCCTCGACTGTGCCGAAATGGCGGATATGTTCACCACTGTGTGTCTGGTGCAAAGATTGCTTGAGAAGATTTACCAGACAACTTCCGCCACCGTCACTGTGCAAGATGGTGCACAGGCGGGACAAACTGTTCCCCATGTACACTTTCATATAATGCCCCGCCGTCTGGGAGACTTCGGGCACAATGACCAGATCTACGTGAAACTAGATGAGCGCGCCGAGGAGAAGCCTCCGCGTACCATCGAGGAAAGGATCGAGGAGGCGCAAATTTATCGCAAATTTCTGACGGACATAAGCTAGCTTTTTACCCCACCCCTTTTCCTGCCATGTGATTTATGAAGAACATATAATAAAGAGATAGATTTTCAATCGGCCATTTCGGAATAGATCAGATGAGGGAATCGATTCATCTGAAATTGACGTACCTCAACCTTCCCGCCCACGGCCACAAGTTTCTTGCAGGCACCGGTGATGCACTCGTTGACCGTATTCACTATGGCCATGGGATCCTGCTCGCACCATCCCTCCTTCTGGAAAATAGACTCCACTTCAATCTGATGAAAGCACACAATTTCGTCAGTGCCCGCACGAAATATAATAAATCGCGCGGAAGTGGTTCCCTCGTCAATAGCCCCAACGA


Search Again