CR00330

CRIMIC CR00330

Gene boi

CG32796

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p0 short band short band79239

Images

Construct Sequences

sgRNA sequence
TTGGCTTATCCTGATTGCGGAGG

Amplicon 5' Amplicon 3'
GTACCGGGTGCCTTAAAGCTAATATTCGAGGGTTTCGAGCTGCTCTGCCGACCTGTCCTACGATTATCTCAATAATACACATCTAGTTTCGGATCCTTAAGTCTACTTGAAACTGTCTGTTTTTGGGGAACCACTTTCGCTTGCCGCTTAGGTATATTTCTCCTCGTTGTGCTGCTCCGCCCACTAGTCCACTAGTTAGTTGCCTCCTCTGCGAGCCATCACACCTCAATACTGTTCAGACTGCCCGACGATATGTTGTCCGTGTGGCTGCCCAGGCGCGTCCTCTTGATCATCGCCCTGCTCGGCATCGGCGATCTCTGGACCCTAGGGCTCCCTGGCACGATGGGTATGCCCACCAGGCCACCCGGATGGCCGGGGTGGTGGTGCAGATGCTGGTGGTGCGGCGGCAGGTTGTTGTTGTTGTTGTTGTGGTGGCTCAGGCCAATATTGAGATTGCTGTGGCTGTTGTGCACCTGCTGGTTGCCCGAGGTGCGTCGCTGTCGCCGCAGGGATGGTATCCTGGTCGGCGTGGGTGTGCCCTCCTCCATATGAAAGCCCCCGGGCTGCTGGTGACCCCTGACACTGCGCTCCATCATCGGCGACGGCTGGTGCGTGGGTGCCTGTTGGTAATAGGCCGAGTGCGGAGGCACCGGCGGCGGCTGCTGGTGGTAGTCCAGTCGCTTGTGCATCAGAGTGGGCGTGCCAGGCGGATGGTACGGCTGTGCGTGGTGAAGGCCATTCTGATGCAGTCCAGAGTTGTTCTGTGGAACATTAGGAGACATAAATTAGCAGGATAGGGCACTAGGCGAATCGTTATTTCATGAGTGAATGAATGACAATGTTGACAAAACAATATCGGCTGGGGGTTGGCTTATCCTG AGGCGGAAAAGCAATAGCACATGGGAGTTGTATGCACAGACTGTCAGCAAGATGATGTTGTCAAAATTGGTATACAGTGTTTGTTTGTATCGGTTGGTATGCGCCCGTGTGCTATTGTTTTCGATCTCAATTGCAGGCTTACTTGGCCAGCGCCGTTTGCTGGTTTCTTGGGCAGCGGAGGTAGCGGCTTGCTGGGCGCCTCCAGCACCGCGTTCGGAGCATCCAGCTGCTCCTGGTCGTGTTTCTGAGGGAGATTCAGTTTAATTGCAGCGTCGCAGGCCTCCAGCGTTTCGCAGGAGGACGAGGCAACCGCCGGTAGCCCCTTTTCATCTTCGTGTCCGTCCTCATCCTGCTGCTCTTCCGCGTTCGACCGCTCCAGGGCTAGATCTCTGGCCATGCAGTTGCCATTTCCATTTCCATTCGCCAGCGGCGGCAGGAAACGCAGCTCCATCACGTTGCGGTTCTGGAACATTGGACTCTCAATTTGCGGGCGAATCTCGACGAGATTTGGCAGAGTTACCAAGCGAAAGTGACAGAGACAGCAAGAGAGAGGGCAAGCGAGACAGAGATACCACGTTCGAAGGGGTG


Search Again