CR00329

CRIMIC CR00329

Gene gsb-n

CG2692

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p0 OK OK78890

Images

Construct Sequences

sgRNA sequence
GTGAATCGGTGGAGCTGGTCCGG

Amplicon 5' Amplicon 3'
GCATAGGGAGGGGTAATCGCGGTCAGGTATGAAATCAAGACACAAGAGATGCCTAAAGCATATTCTAATTAAGCGTGAAGCTCACCTGGAGGCAGTTTTTACGCCTACTGCCACGCAAAAGCGAGCGCACACAATATAAGGCCTATAACACCGAAAACAATCAAAATCCCGATCTAACGGTTTTTGTTATTGTGAGGTCATACAAAAACAGCAATGTGATTGCATATTTTTGTCATTCATAAAATTTTAAATGCAGTTTTTAATTTTTTATATTAATAAAGCACTAGTCCAGCACTCTTCCCATAAAAAAATAAGAAGATAGTAAGCTAAAAACTTAGTTTATTAAAAAACTACTTTTGCGAATTAAACCATCCTAAATTTCTTTCTGTGCATATTACACAGTGCGCATCTTTTGGATTTGGAATGAAGTGATGCCGACTCTGATCTATAGTCCGATCGTATCGATCGCCCGAATCCTAACGCCCCATAAAGTGTGGCTAATTGCGGTTTCAAATAAAGAGCGGGACGATGCCGCCAAAAGAGGCTGGCGCATGAATACACTAGTGCTTGTATTAATCCTAAACCCTACACTCCCTCCACCGTCGAGAAGTTTTGCCGAAAGGGAAAATCAACTTCAAGACGGCCGTCATCCATCCATGCAGGCGTGAATC CGGCTAGTGGGCAGTATGCCGAAATCTTTTGCCAGACTTTTGGTCTCTGTGAATGAGTCATATTGGCGTAGGTTCAGTAATGAGCTGAAACACAATTTCCCCGTTGGACTTCGCTTTTGCCACATAAGGTGTGGGGAAGTGTGCTCATCTTTTAAGCTTAACGCAAATCTGAAGCAAAATAATATCGCAGTATTGGCAAAGGTGGCTAGGTTTGTAAGACGGCACATTAAAACAGAGAATAGATGACAAGGAATATGTCGTTAATTATAAATTTTGTTAATCTAATAAACGAAACGAACTTATATGCGAGCCATTTTAATGTTTTGATGTAGGACCGATTCTTTCACGCCTCAAAACCGGAAGCGAAGTCCCGACGGCGAAGAATCATATAAATATATTCTCGTATAGCACCTTTTCGCCTCAAGGACAAAACACAAACGATGCCGACAAGGAACACGACAGAAGCGGTGTCTTTATGGTTTAATTGATTTCTTAACGGTTTGGGTGGCAAGCGAAAATTTGTCGTCGCTGTTGTTCAACAATATTGTCAATGAGCGGGCAAGTTCAAACTGGGTCCTTGGTCAGTTTGGGCCATCTGTGCAGCTAGTCAGCCGACATATGCAAAAGGCCAGTAGGTGTCATAGGCAACGTGCCATAACAAAGCCAGCGGGCGGTACGAAACTGCCACGTGACTTTTCGGAAAACGGAAGTAAACTGATTCGCATTCGGTGCGTATTTTGACCCTCTTCTATCTGGACATATTGGCATGCGGTTAAGGCTACCGGCAGGTCCTGCAAATCCTCGCATCGTTTGTTTTGGTACATTTTATTGCTTCCTGCAACCTTGCAGGTGCATCTCGGTACTCACCTTTATCAGCTTTTCGCGTATTTCCCAGCTGAATATGCTGGGGTTTTCCTTTCGCAGCTCATCGATCCGCGTTTCAATTTCGGGAGAGGTCACCTTGGGCTTAGATCCACCTATTACGCCCGGTCTAATAGAACCCGTCTCCTGGTATCGGTTCAGAATCTTCGATACGCAGCCGTGAGACACGCGGAGCTGGCGCGATATTACACAAGGCCGCACTCCACTGGCCGCCATTTCCACGATCTTCAGTCGAATGTGATTGGGCAACGGACGTCCATTGATAAAGACGCCCCCAAGCTGATTTACCCGGCCTTGTCCTG


Search Again