CR00328

CRIMIC CR00328

Gene CG11208

CG11208

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p0 short band OKOrder from Bellen Lab

Images

Construct Sequences

sgRNA sequence
TGGAGTGGTCTCTTATCTTGAGG

Amplicon 5' Amplicon 3'
CCGATTCCCTCGTGATCCTGGTTGGTGGCACCACCAATAACGATTAGTGGCCAGCAGTTCACCTGGGCATTGGCCATGCCACCTGGATGGTAAAGTGAGAGGGATTAGTGAGGATTAGCCTATCTGGAATGTCTTAGTCTTATTTTATTCTTACCCGTAACATGGAGCAGTCCCGGTCCGGACACAACCAGGCACACTCCCGGCTTTCCAGTCAGGTAGCCAATGGCCTGGGCAGCATAGCAGGCGGCTTGCTCGTTGCGCATTCCGATGTACTTCAGTCCGGCGGCCTGGAAGGCCATGGACAGCTCGATGACCGGGATGCCGATGATACCAAAGACATATTCCACGCCCTTAGGAATACAGTGTACATATTTAGATTATCTATTCAGCCATCAATCAATAAATCAAGTCAATAACTATGGAAATTTATAGAGCACATCACTATCCAATGTGCAAACACGTTCTTAAGTGATTTGCCCGGAATCCGGTTAAAGTATTATTGATTTTAATCTGCCCCCCGGCGATTATCGCAGCTGCAAGCACCAATGTGTTTGGGTCGTGGTCCCAAACCTTTGGAACATGGTCTTTATCAAATCCGCTCCGTCTTTTATTAACCGGAGTAATCGGGGGACATTCTCACCAACAAAACAACAACAACCACACCTACAGTTACCAAGTGTTTTTGAACTTTGCACAACAAACAGGTGCCTC CTCCATTGTTCTTGCCAGCGCCACAGATTCCGCGGCCCCCGTTCACAAATGAGATATATAGTAGTTGGGCAATATCCCAAGTGCAGAAAAGTGCAGTGCCAAAATGTCGGACAAATGGCTGGACGACCAGGTGATCCTCTTACCTGTTGCTTCAAAGATTCTGCAATTATCTGCACGGCTTCAACTTCGGCCATTTTGCGCGGTTTTCAGTGAGAATTGTACTAAAAATGTAATTTACGCCGCCGCGTTTTCTTGCGTACTGGCCCAAGAATTTGTTAAACAAATTAAAATGTAGAGTCCAACAGAAGCGGTGACCGCTATCGATGCATTGGTATCGATGATTTCCTACCCCCCGCACAGCGATTGTTGTGGCTATCGATGCGCACAGTCAGTGTATACTTATGCGATAGTCATTGAAAGGAAACATACTTTTAATTATGCGAGCAAATTCTGAAAGGTAACTGCAAAGCTCGAATCATTTCGTCAGAAAGATAAAATGCCAGTGATTTTTTTAACATTGCTGATATTTGAAACACTCTCATCTCTACTAACCCCATATACCAAACGTGTGTAAAAATCAGTTGTGAAAGAATACCAACATTGACATACCAGCTCGTTATCGATGCGACAGCCCTTTTATCGATAATTTCTAATTTCCCGCCTATGTTCGAAATTTTTTCTAAGATACCATAATTTCTTTTTTTTTGTATTTGCTTTATTGCCATGCCTTTCTGGGTTGCTGAACCTTCTGCAGTTGATAGTTTATGTATAAGCGATATGTGCAATAGTAAAAGAACTCAACTACTGAAATCATACTTAGTCCGAGGCAGAGGT


Search Again