CR00323

CRIMIC CR00323

Gene Marf

CG3869

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p0 OK OK78889

Images

Construct Sequences

sgRNA sequence
TGCTTTGGGAAGAGTCAACAAGG

Amplicon 5' Amplicon 3'
CATTCGCGAAGTACTGCAGCGGGATCACATGAAGGTGGCCTTCTTTGGACGCACCTCCAACGGCAAGAGCTCGGTGATTAATGCCATGTTGCGCGAGAAGATCCTGCCCAGCGGCATTGGGCACACCACGAATTGCTTCTGCCAAGTGGAGGGCAGCAATGGCGGCGAGGCGTATCTTATGACAGAGGGCTCCGAGGAGAAGCTAAATGTGGTGGTAAGTGGGCTACTCAGCTCTCCTCTGGGAAATGTGTTTCGCCTAATGACCTAGTGACCCTTGTTTGCAGAACATCAAACAACTGGCGAATGCCTTGTGCCAGGAGAAGCTCTGCGAGAGCAGTTTGGTGCGCATCTTTTGGCCGAGGGAACGCTGCAGCCTGCTGCGCGACGATGTCGTCTTTGTGGACTCACCTGGTGTGGATGTGTCGGCCAATTTGGACGACTGGATCGATAACCATTGCCTGAACGCCGATGTCTTTGTGCTGGTCCTGAATGCCGAGTCAACGATGACGCGTGCGGAGAAGCAGTTCTTTCACACCGTCTCGCAGAAGCTAAGCAAGCCGAACATCTTCATCCTGAACAATCGCTGGGATGCGTCGGCCAACGAGCCCGAGTGCCAGGAATCGGTATGATCTTCTAGGCGGCCCCTTTAGTTAGTCCACAATCTCTGTCAGACCCTGCATTACCATTACATGGCAGGCGAACCATATGCCACATATGTGTACATATGTTCGTTTGCCAGCAGTTTTGCACTGCCACATCTCATAAGTAATTTCTTGGACCTCTTCGTATGCCTGTTGTCTCTCTATGTTGATGTGTGTCTTTTGTTTTTGTTTATTACCCAACCAACCAATCAATCTATCAAACAACCAACCAACTATCCACTGTAATCAACGCCAGGAATTGGCTAAGGTAATGAATGAGCTAGACCCGCTTGCTTGGTCCCACAAAAACCCAATCCACTCTGCTTTGGTCTCTTTATCGAATTGAACCGATGAACACC CCTCCTTGTTGACTCTTCCCAAAGCAGCTTACTTAGTTGCCCTGATTGATTGATCTATGCACTTTCTAAGACGCTTATTTCATCAATTGATAGGTTAAGTCTCAGCACACGGAACGCTGCATCGACTTCCTCACCAAGGAGCTAAAGGTGAGCAACGAGAAGGAGGCGGCCGAAAGGGTATTCTTCGTTTCCGCCAGGGAAACGCTGCAGGCGCGCATCGAGGAGGCCAAGGGCAATCCGCCGCACATGGGTGCCATTGCCGAGGGCTTTCAGATACGCTACTTCGAGTTCCAGGACTTCGAGCGCAAGTTCGAGGAGTGCATCTCGCAGAGTGCTGTGAAAACAAAGTTCCAGCAGCACAGTTCGCGCGGCAAGAGTGTTTCGGGTGACATGAAATCAATGTTGGACAACATTTACGAGCGGATCACCATATTCCGCAATCTGAAGCAGGACCAGAAGAACCTGCTCACCGAACGCATCCAGGGCACAGAGACGCAGATGATGCAGGTTACGCGGGAAATGAAGATGAAGATCCACAACATGGTCGAGGAGGTGGAGGAGAAGGTGTCAAAGGCGCTGAACGAGGAGATCTGGCGCCTGGGCGTACTCATTGACGAGTTCAATATGCCCTTCCATCCGGAGCGTTTGGTGCTGAACATCTACAAAAAGGAATTGAATGCCCATGTGGAGAGCGGCCTGGGCAGCAATCTGCGCGCCCGCCTATCCATGGCCCTGGCCATGAACGTCGAGTCCGCCCAGACGGAGATGACCGATCGCATGCACGCCCTGGTGCCCAACGAGCAGCTCCTGGCCACCAGCACCAAGATGGTGGTGCGCACGCAGCCCTTCGAGATGCTCTACTCACTGAATTGCCAGAACCTCTGCGCCGACTTCCAGGAGGATCTGGAGTTTAAGTTCAGCTGGGGCATTGCGGCGATGATCCAGCGCTTCACCGGCAAGGTGCGCGAGCGCAGCAAGAAGGGCCAGCCGGCGCTGGTCAATCGACAGAGCAGTATTGGAGTGAGTTTCTACAGTATAGTTGTGTTGCACCACCTTTACTATATCTCTGCCATCGAATCTCGTTCACAGCACAGCGTAT


Search Again