CR00316

CRIMIC CR00316

Gene CG1673

CG1673

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p0 short band short band79238

Images

Construct Sequences

sgRNA sequence
CGACTTGTTTACAGAGATTGCGG

Amplicon 5' Amplicon 3'
ACTCAGAGATGCAAGGTGCCATTAACTACACTTCTTTACAATTCGGGAATTGGGATTAAATAGGGTCAAGGTTCTTGCTCTTCAAGAGCTGTCAGCAGAGCATGATCAAATCGACTTATGTGTTCAATTTTTTCACACTTGCAGGATATTTTCCGCAATCAGCATCGCCTGATCCGCTTCCTCGAGCAGTCGATCCGGTTGTGCAGCAACCAGTCTCTGAAAGCCGCCCAAGCGGCACAGTTGCAACAGAAATCGTCGGCGGACTTCGAGATCACCGCCTCGCTGGACGCCCAATACACCAGTGCCCCGGAGCCCATTAAGCATGACAAGAATCTGGGTCATCAGTTCCGTGCCTCACAGATTTCCGTGCGACTGGCCGCACCGGAGCAACTGCAGCCCAAGCCGGACAACGATGAGGAATTGGGTTTCGGCCGCCTATTCACCGATCACATGCTCAAGATCTACTACCACAAGAGTTTGGGCGGATGGCAGCGACCGGAGATTACGCCGCTGGAGAATCTAGTGATGCATCCCGCCGCCAAGGTCCTGCACTACGCCGTTGAGGTAAGCCATCGGTCCTGCGTTTTCACACTAAGAACATATCAGTAACAGCAACAAAAAGCATAGCTTAGAAAAAAGTTGAACAATGTAACTAGAATTCCTTGTTGAGTGCAAATATTTACGTGACTTGAAAACGCTTCGTAATCCCCAAGTCCCCAG CCCAGACCGCAATCTCTGTAAACAAGTCGCACGTGTGACTTGTGAAGCAACGTCATGCAGATTTATAGTATATATGTACATATAGTGTAGTCAGAACCCAAATCGAAATCAGCGACTGTTGCCAATGGTGCGATGTTGTCTTATCACCTCTGTAATGCCATCCATTCCATTGCAGCTCTTTGAGGGCATGAAGGCGTACCGCGGCGTCGATGGCAAGATCCGCATCTTCCGGCCGGACATGAACATGAACCGCATGAACCTGGCCGCCCAGCGATCCGGTCTGCCCACCTTCGAGGGCAAGGAGTTCGTCCAGTGCCTGTCCCGCCTGCTGTCCATTGATTCCGAGTGGGTTCCTCACACGGACACCGCCAGCTTGTACATCCGCCCCACACTGATCGGCATTGATGTGAGTATATCTAATTAACCGTATCTACTTTGGAATATCATGAGCTTACCTGTTTTGATTTCGACTTGCAGCCCACACTGGGAGTTGCTTCCTCCGACTCGGCCCTGCTCTACACGATCCTCAGCCCCGTGGGCAGTTACTTTAAGACAGGCTCGTCCGGTGCCGTCTCCCTGCTGGCCGATCCCAGTTATGTTCGTGCCTGGCCAGGCGGCGTGGGCAATCGCAAAATGGGCTCCAACTACGCACCCACAATCAATGTGCAGAAGGAGGCGGCCGCCAAGGGACTGCAGCAGGTGCTGTGGCTCTACGGCGAGGATCATCAGCTAACCGAAGTGGGCACCATGAACATCTTTATGTTCTTCGTGAACGATCAAGGAGGTTGGTGTCTAATACAGCAGCAAAACGAATGGGATTGCTTATATATATATATCTATGTCATTTGCAGAACAAGAACTGGTTACCCCACCGCTGAGCGGTCTAATCCTGCCCGGTATCACCCGCGACTCCATCCTGCGCATGACCCGCCAGTGGGGCAAGTTTAAGGTTAGCGAGGCGAACATCACCATGCCCATGGTCTGTGAGCTCCTCAACCAGGGAAGGGTAAGTAATCTAACAGAGCATTTCCCCCTCG


Search Again