CR00312

CRIMIC CR00312

Gene CG15923

CG15923

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p0 OK OK78888

Images

Construct Sequences

sgRNA sequence
CGGATTCGGCTTGATCGACTAGG

Amplicon 5' Amplicon 3'
TGTTTGTACGACGTGCTCGATTAGCGGACGTTGATGTGTGCTAGCTATCCTATTGCAAAACACGAGAAAAGCCAAGTAGATCATGCGGGGCATCTGCTAATGTTTGTATGATAAATGTGAAACTATGGAAATTATTTTATCTGTTTTAGCCGTAAGTTTTACGATAACTAAAGATTAACCACTGTATATGAATGTACTACTTACTATCGAGTGGATTATGAAATAATAAAAAAAAACTTCCTGTAAGGGCTCGCATATCATTTATATGGCAAAGAATCCATCCTCTCGCAGATATTGCTCCTCGTTTTGAGGCTACAAGAGGAACCTCTCGTCGATGAGGGTCTTGCGGGAGATGTTCCTTCGCACCCAATGGCGGAACACTTGGCGTAGTAACTGAAATGGATTATTTTTTAATTATTTTGTTAATCAGTTTTGAATCATTATCCTACTATGTTTAGGGCACAAGCGCCAGCAGCTGCAATTAACAAATTAGAGGTCATCAAGAAGATCGACAGCACCAAGAGGAGTTCCAGGACAAAGATGTGCAAATGGTTACCCAAGAGGAGAACGCGAGAGAAGCTGAACGAGTCGTCTATGTAAAAGGTACCTCTGTCTGAAAATTTAAATGGATTTAATACATAAAAGAGAAACTTCGAATTGGGTACTCACTTTCCGTGATGTAGTTGTCTATTTCGCAGTTCAGCAATTGTTCCACAAACGACTTTTCCTTAATAATGTAATCCATGTCCTTGATAGCCTGTCACAAATATAAAAAGAGAACATTCCATCTTAGAATAAAACTGAGCTTACAAACAGCAAAAAGAGTTGAGATTTATTAGTTACTAGGTATTCTAGACTGTAGCTCTTAATAATGCTAGAATCTGTAAGCTTAGTCTTTCGATTTTTTAGATCCTCAGATCTCAGATCTTATACGGGCAA GACGGATTCGGCTTGATCGACTAGGCCATATTAACTGGTTACATACTTCAATGGATCAATTAAGGTAGACTTTAAGCTTACATGGTCGATAAAGGCGCAGAAGAAGCGATTGACGCTGGCGTACGCAATGGAGGTACGTTCCATCTGTCCATCGATGCTCGGAACGATGTCCTTTTGGTAGAGCATGGTCTGCGAAAGGGTGCCGGTCAGACTGCGCTGAAAGGGAAGCAGGAGTCGCTCCAGGTAGATGCTATAGTAAAAACACTATGATAATCAATATCCTCATTGGAGTAAAGTCAAAATCTTACTGAAGGTTTCTGGGAGGCAGGATGACGTACGCCTGCTTGTCCGAGTCCATTAGCAATCCTCGTCGCCCACACATGGTCTGGGTTCTCTGCAGCTGCAAAATCATCGAGGACATATCCGTATCGGCAAAGCCGTGCGGAGATCGTCCGTGGATGTAGTAACCAAATCCTGGCTCCGTCAGTGAGAACAGAGAGATGTTGGCCAGACTGCACAGGTCGATGAACTTCTGGAGGGGATTGGCTATAAACAGTTGGTGGCCTATTATCTGAAGTAGATATGTGAGCAGATAAGCTGCCGCTATAAGGCAGCAACGTAGAAAAATGTCACCCTTGGTAAACCTCTCCAGAAACTGATAGCCAGCGATGACCACAAATACCTGACCCAAGGTGGAGTACTTCTGGGTGACACTTAGGCGAATCCAGGCATTGGCCGTGAAGAGAACTCGCCAGGCGGAGACGCTGCTCTCGGCCACAAAGGTGCGCACGCTAGAGCAGAGAGATGAGCTGTCCAGATTCAGGCGTTGTCCTTCGCAGCTGCTCCGCGGTCTTTCCCAGTCGATGAGAAACAGTTCCAGCTGGCTGGAGCGCCACAGGTGGATGCCCAGAAAGAGGAACTGCAGCACAAAGGCGGTATTGAGTAGGATTTTCAGTAGGCGAGAATTGGAGGCTTGCAGCAGTAGGAGCAGCAGAGTAGTCGCCAGCAGAG


Search Again