CR00309

CRIMIC CR00309

Gene Drp1

CG3210

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p0 OK short band79236

Images

Construct Sequences

sgRNA sequence
GCAGATTAACTATTCTTATCTGG

Amplicon 5' Amplicon 3'
ACCAGCGTTAGGTTGACCACGTGCGTTGAGAATATCTTCAGGTTGATGGGCTCCGGGCAGATGCCCTTGTTGCTGCCCGCCGCCCGCTCCGTTTCGTTTTCGATCTCCTTGCGGATCTCGTCAAAGTCCGTGAAGCACTTCTTGGTGTGCAGGAAGCGGCCCCACTCCTCGGCATTGGACGTACCTAAGTGTTATGTGGTTTAGCAATTGGGTTTTCCCGAACTTCTGACGTCTCAACTCACCATTTTCCGCCGAGCGATTCTCGCGATCATCGAGTGGGCTGTAGATCAGCTGGAGCACCAGTGGGCGACGGGTCACAATACCAGTTCCACGGGGCAGAAAGGATCGTCCCACAACGCTCTCGATCACCGAACTCTTGCCGGAGCTCTGGAAAAAAGGGGAAATGTATGTATTACTGGGAGTTAAAACGACGGCTGATAAAAGACGATGACCTGATAAGGTGGCTCCCAAGCGTTTGCAGCGAGGAAACACTTGGAAAACCGCAGAT GGAGCCATTCTGTGATTGCAAATTTCTCAAACTTAAGCCTTTGCAACAGAAAACCAAATGAATGGTAAGAAATGGCACAGATTCAACATATTGGAGCTCCGCTGTACTCGGTATCAATGAGTTGCGCGAGCATTTAGTCATACTGACTTAATTCCAGAGCGTGAATCAAAGTGCAATTAAGCCAGCGATCGAAACATGCACACATATATGTACATACAGACACAACTATCGAAGTCACACATGTGTACGTTTGTTTTTTGCAGTGTGTTCGTGGGGGAATGTGTCACATCAGCCAGCAGCTGTTTTTTTTTTCGTTTTTGTATAATACTGTGGCATATTGATTTTCCATGGCGGCGGCGAGCAGTGCCAAAAATAATTATATAAACAATGGGGACGCCGCGAAGAGCGAAAGCTGGCTGAAATGTTGCTACAAACTGAAAACACAACTAAAATGCCGGCAAACGCACTCAGTTATATAATTTTGCGGTCACTGGAAAAGCGCAAGAGTTGGGGTTTCAGATAGCTGCGCCATATTCCGGTTCTCAGTTGCCACTCCTTTTACGGAGCTCGGGGATTTATGGTTTTCGGTGTGCGGATTTTTGGGCACCTCGCAGTTTGCATTTACCTGACTGCCTAGAACAACAATTTGGGGCAATTGGATGGAGTCGGAGCCCACGGTGTTGAAGACGTCCTGCAGCTTGTTTATGACCGGAATTAGGGCCTCCATTCTGAGTGTGTGTGTGTGCTGGGTTCCTTTGGTCGCGTTCCACTCGGCTGGCGATTAATTCGCGCACATAAAGGCCGTTCTTTTCGGCTTTTTCTGATTGACGCGAGCACCGAAATTATTTTTGCAAACCGCCAGTGTTGCACAGCAAATTTAGACTGTTTTTCTAGCGGTGTTGCCACACGGGCGGAACTTGCTGCTATCGGCAGTCCCTAGACGA


Search Again