CR00305

CRIMIC CR00305

Gene Etl1

CG5899

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p0 OK OK78887

Images

Construct Sequences

sgRNA sequence
GAACAGCTGTCGTTAGCCAGGGG

Amplicon 5' Amplicon 3'
CTGCGAGCCATGGTACTTCTCCACCACCAGTTCGGGACACCAGCGGCTAATCTCTGCCTCCCAATTATCCAGCGTGGACGAGGGCACCACAATTAAATGTGCAGCCTGGCTAAGACCATTCTCCTTTAGATAGGCCAGAAATGCAATAACCTGAATTGTCTTGCCCAGACCCATTTCATCTGCCAAAATGCCATTCATTTCTTGTTTGTGCATTACGGTGAGCCAATTAAGGCCAATTATCTGATAATCAGCCAGCTGTAGACTGCAAGAGGAACGAAAATAGAAACACAAATGGGGACATGCATGCTGGTTAAGGCTCACCCGCTGCTAAGAAGCTTAGGTTGCTCCACAATGCCAGCACCATTGGAAATCGCCTTCTCCAGACGCGACACCATGTTATTGCACTTACTTAGAATAGCGGCCACCGTGTTCTGTTTGTTAATCAGCTCTTGAGCGTAATTCAAAAGATCACCCGACATCCTGATGCTCTCCAGCTTTTGGCGCAAATCAGACCAATCACTAAATGGTCGCACATCAATGATGGCTAATGCCTTCTTCTCGGACAGCGTTTTAACTGACTGGAGTTCAATTAGCGAAGCCTCGTTCATAAACTGGAAAACTTTTTTACGTTGCCCCGTCATCTTGGTGGACATCTCGCTATCGCTGTCATCGCTATCATACACCTGGTCCTTGGACTGCTTCACATCATCGTCGTCCGAATGGTCGTTATCCGAGAAGTTGCCTCCACTAATTCCGTTTGACCTGGGTTTCAGCTTGGACTTGGCCAGTGGTCCATTGTGCCCCTTGGGCTTGCAGTTCTCCCTTAGGTATCGCACGGAAGCGGCCACATCCCAATTGGTGCGGGAAAGAGACTCCTGGATGGCCTACGGAACATATTTGAAATTTATTTCAGTTAAAATCGAGATTTATGCAAAATATTGCATTAAAAATGAGCAATTTTAAGCTATAAAATATTCTGATTAATTTTAAAATTCAAATAAGAACGGTGATAATGTCCGGAAATATTTTATATGAGGCACACCAAAGTAGTGGAAACAGTTACACGAGAGGGTTATTACTGCTCCCATCCCCGTCAGTGACGCCCCTGGCTAACGACAGCTGTTCGC CGAACCGAATCGCCATGTTCCCCGAACTCAGATGCAGAGACGCGCGTTTCCCCGCGAATCGCCCCGTTTTACCTTGGTGGCATTTCGGCCGGAAACCTACCATTGTGTCAAAGTGGGGCGAAATCTTGGCGGCTGCCATGTAGCGCTCCTCCTTTTCCTTAACGGTCAGCTCCAGTTTGGTCTTCTTGGGCGTCTGGGAGTCGTTGCCATCGCTGTCACTATCGGCCATCACCTGGATGCGCTTCTTTCCAGGCACACGCTCTGAAATCAGGCAGTTAGCTACCGTGTCAATCGCTTGGAATTTTAGCTCAGCAAGTACCAGTTCTCGAAGGACTAGCGACGACAGAGGAAGCATTCTTGTTGATGCGGAACTGACGCAGATCGCTGAGGCTCGACTTCGCGGACGATGAGGCGGAGGCCGACGCAGATGCGGCCACTGTGCTGTCCGACATCGTGGGACAAGGCGAAACGCTTCCTGGCAATCTGTCAGTCCTTATTAACAAATTCTGTTTGCAACTCCTACAATCTTAAGTTGGTATTTGTGAATATTCGCATGCTAGTGCGGCCGTTTGATTATCCCGATAAAACCTATTTCTATTTCTCCAACGGAATGCGGTCACACTGTGCGCCAATTTAAGTATTAGCTTAATGATTATTATTATTTTTCATTTATTTTTATCGAACTGTAACGCATTAGTGTAAGCTTCTATGAGATTATCTAACAATTTGCTTTTGTATATATCGTATATGATTTGATTTCGTCAACCTAACCGTAAGTAATTAAAACCGATGCCAAAATGAAAGAAAGAAACTTAAAAAAATCCCAAACTGGCGGTAAATTAAGAAAGTTGCCAGAGTTGCCAGATGTTATCGGCTTACCGCAAGCAATCGGCCAACAATCGAAACATTGGGACGCGTTGCAACCCTCTCTTTTTTTCGCTTGCTCTTGTAGGTTAATTGAAAACACTTTTATTGCAAATAAACCGCTTGCCGAGCCAAGGGCAAACCGATAAACTGGCAAACATGGCTGGCGGCAACACCCCGCGTGTGATCCAGGTGACCAACATAGCGCCGCAGGCCACCAAGGACCAGATGCAGACGCTGTTCGGGAACATTGGCAAGATAGAGGAGATCCGCCTGTACCCGACAATCCGTGA


Search Again