CR00304

CRIMIC CR00304

Gene CG4887

CG4887

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p0 OK short band79235

Images

Construct Sequences

sgRNA sequence
ACTGTGTAGAGTGTGAATGAAGG

Amplicon 5' Amplicon 3'
GAGAGAAGGGGCTCCTCAGATTACGACAGCGATGAAGGCCACATGCGCAGGAACAAATACCGATCCACCACTGAAGCCCTCAATATTATTATAATCTTCGGTCTTACCAAGGAAATGACCAGAGCAGATGTAAGCCAAGCAGAAGAGTGGCAAATGCAACTCCTTTAATTACTCATGAACTAACTTTTTTTTTAGATTATGAGCGAGCTGATAAAGGTGAACATGGAGCCAGCGTGCATTCGCATTATCCGGAAGCAGGGAACAGGTGGGTTACGAAATCACTGACTTTGTTCTTTCAGCGTCAGACGTAAGTAGGTCCAAAAAGTTGGAGCGGCTTCGCGCTAATGGAGGCGAAGTGTACAAGTACCAATCGAATTTAACCGGCCACATGAATCGAAAAGAATACAATAGTCCACAAAAATGTTACAAACCTATCGAAACATTCAACATTTTTTGACGAAAACATTTTGTATCTGCTTCTATCCGAAAATTTAGATTCATCACGCGGTATAGCGTTTGTCGAGTTTAACACCGTTGAGGAGGCAAAGCAATGGATGGATATTACACAGGTATCAGCGCAATCGACCAGATCCCCTTGAAACTTTGATCATCATCAGCAGCCAAGGTTGTTCGCAGGCAATGATAATAAGGAATTCCTCACTGTTTAGCTTGCTTTGTCCAACTAAAAGTACTTATATGTAGTTGCAAGGAAACTAAGCACGAGTATAGTATTGCTTCATTAGAATTGCCCAAGAAAGCCACTCGAGGAGATTGCCAGCGGCTAAAACTTCGCGTTACGAAACACAGATGCAATCCGGTGACTGTGT GGCATCCTAGCGATCGGTTACTAATCCGCAACCTTTCCTTCTCCTATTTCCATGTCTGGCGCACCAGGGCGTTCTGAAGTTAAACGACGAGCGGGTGAGCATGCGGTACAGCCACAAGCGAATTCAGGACTGGAACTGCAACAAGGTAGGTGCACTGAGATGATCATATTCTTAATGGCGAGTAATGTGTTTCGCTTGTTCCAGTGTGGCGTCTGCAACTTCAAGTTTAGATTCTATTGCTTTGTGTGCAAAACATCCCGGGAAGACAGCGAAACCACCTTCTCCTCCGGTAGCGAGGGCGTGGACGAAGTCAGCACCATCCTCACCAAAAGTATACAAACCACATAGACTCTCTTGCCATCTCGTTTTGTAGCTTCGATCGCAATGAAGTCCAACAGACCACTGACCGCCACGATTTCTCTACCACTTCCCCAATCCACGCAGAGATCATGCTACGCAACCTGGACGCCCTGACCAACGAAGAGGCTGTGCTCACTGCCCTCCAACTTCACCTAAAGGATCTGAGCAAGACCGTGAGCAAGGTGCTAATTAGTCGGGATTCCTTGACGCAGGCATCGCGTGGAATTTGTTACCTTCACTTCGACACTCTTGTCGACTCGATGAATGTGCACAATGCCTTGACAGCGCTGGATCCTCCACTTACCTTGGACGACAGAGTTGGTATGTGGCCTTAGGTGCTTTTTATAACTTAAATAATAACCAATATTTCATCCAGTGGCCATTACCTATTGCATCGACTTGGAGGAGCAGCAAGCATTGCCCAAGAACCCT


Search Again