CR00286

CRIMIC CR00286

Gene ADPS

CG10253

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p0 no band short band79234

Images

Construct Sequences

sgRNA sequence
TTATGACAATGTGCTATTTCCGG

Amplicon 5' Amplicon 3'
CAAGCCGCAAATGACTTCGATGAGCAGATGAGAAGACAATGATCAGCATTTCGTATTTGGTCTGCAGCCGGGACACGCACACGCAAATCAGTTGTTGTCTATGGCCATTGCTACACAGCAAGAAATAGGTATTCAAAATTGTAAAGAAGAAATGCTTCAAGAGAAATACTCCATTTATTTATCAAAACCCATAGAAAACATGAGCCCGCTACAAAAGAACTGGAGACCCGAACCCCCAAGAGCGACTAGGAAAATCAGTAAAGTGACTAAGACTAGTAAACGAACTAAGCGCACTATCTAGTTGGCTACCCTCTACAATTTGGCCTTTGGTGGTGTCGATGATGTGGGTGGTGGCGGAGAAGCCTGAGCCTCCTCCAGGGGCAGAAGGTTACCGAGAGCAAAGATATTCTTCGGATCGAGATGCCGCTTGGCCGCCGAATATAGTGAACTGCCCGTTTCCGTGACGGCATTGCGGTACCAATGGCTTCGTATCTTTCCCACGCCATGGTGATGGGACAGTGATCCGCCGCAGGACAGTATCTCATCGCGGGCACTGTGCTCGATGGCCTCGAAAAGCTCGACGGGATCGGCCACGTCCGTACTGCGGAATCCAAAGTAGAAGTAGATGCAGGCACCGGCATCGTAGGTTTGGGTTACTCTACACGAAATGGTATAGTAGTTAATACTACGTTTGCTGCACTCCTGCAATGGTCGAGATGATAATTATTGTTTATATGAATAATTTTTAATATAGCACACACCGAAACAACACGCTGCTTCACAGAACGACAGAGCAGACTGCAGCGATCCCAAGGCACCGATGTCTCAAAGGACTCCGCCACAATTCCCTGATGTAGTCCAAAGTCCTTAAAAAATATATGAACATTAAATGAATATTTATATAAAAGATAATATAAAAAAGGTTTGTATTAGTGATAAATAAATCTTTATAAAAAGTTTGCCATTTATTCTTATATTAGTTACAGATCAATTGTGTTAATTATTTCCATATTAGCGCTGATATAATATATATAGTCCGCAATCGATCGAAATGAGCAAACTACAAATTAAAATCATTCTACCAAACGACTCGAAAACCAAACAACAATAATAAATAAAAATAGGGAAACGTAAAGCCGGA AAACCGGAAATAGCACATTGTCATAAAGATAATGATGTTGATCTTTACTTTTAGTTTCATTTGTACAAATTCAGAAAATACTCACCCTAATGTAGGCAATCACAAAGGTGAGTATATAGCCCCGTTCCCCATTTTGTCCACCTGCCGGAAATCCCTGAAACTTTTCGGCAATCTCGTAAATGAGTGCCTCCTGCCGCTGGACATCCTTTAAATCGCCCTCGAAAAGCAAGGTGGCCGCGCAGATCTGATTGAGATCGATGCCCTTCCAGGAGGTAACGTAGCGCTGCTTCATGGCATCCACCACACTGGCCCACCAGGACTTCTCCGGTTTCAGGGCCTGGCCGAACATGAACTGCTCGTTGTCCATCAGCCGGACGGAGGCGGGTTGACATCTCCTCCGCGCCACTTCGCGCATGAAGAGCACTCCCTGCTCGAAGTTGGGAAAGGCCAGGGATCCGTAACGCCTCAACGATGGCAGGGGACGCACCTTGAGCACCACTTCGGTGATTACTCCCAGAGTGCCCTCGGATCCCAAGATGACATGGTTGAAATCAGGTCCACAACTCACGCGCGGCGCACTGCATTCACGTTCCAGCGTTCCCGACGGAGTGACCATCCTAACTCGCACCACCAGATCCTCTATGTTACCATAGACGTTCTTCTTCATGCCAGATGCACGAGTTGCCACCCAGCCGCCCAGGGTGCTGAACTCATACGAATCCGGTTCGTGGCCAACTGTCAGACCTTCACTTCGCAACACCCTCTCCAGATCCTGACCCACAATGCCGGACTCAAAGCATACGGTGAGATTCTCCCGGTTTAGCCACAATAGTCGATTCATCTGAGAGGTGTCCAGGGCGCAGATCATTCGGCTCTCGTTCTGCGGACAGGTGATGGCTCCCGATACACTCGTTCCACCACCAAAAGGCACCAGCATCACATTGTGCTTGTTGGCCAGCCGCACCAACTGGACTACCTCATCGTGGCAACGTGGCCACACCACCAAATCGGGTATCCGTCGAAACTTGTGGTGCCACAGGCTGTATATATCGTTGAGGGTCTGGCCATGGCACCGCACCAACCGATCGATTCCCTCCGCAGAGTAATCCA


Search Again