CR00284

CRIMIC CR00284

Gene CG12766

CG12766

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p0 no band OK79233

Images

Construct Sequences

sgRNA sequence
ACGTTAACCCGGCTACTGATAGG

Amplicon 5' Amplicon 3'
CTCCGATGCTCTTGGTCAGGCCCAGGTCAACCAACTTCTCCATGGCGCCCCAAGTGTCCAGGTAATCAATGTCTCTGTAGTTTGAAGCAAGTAAACGGCATAGTAAGATTACTGATAATAGAAGGCGCATTTCACAATCACTTGTAAGTGCCAATCGATTCGAAATATTTCATATATTATTCATTTTACTCACACAAGTTCCACCTCTCCATTGGCATCTTTGGGAATCAGTTCGTTATCACCGCGATATTTATAGGAGAAAGGCCAGTGAATCAGATAGAGGTCAACATAATCCAGGCCAATATTCTTCAAGGTCTTTCGGCAGGCATACTCCACCCTTTCCGGTTCATGGAAATTGCACCAGAGCTGCGGAAATATGTGGCCACTTAAGGATTAGTTTATGATATGCCTGCTATAAGAACTTGCCAACTGACCTTGGTGGTGATGAATATGTCCTCCCGCTTGATGACGCCTTCGGCAATCTTCTTCCGAACCGCCGCACCCACTTCGGCCTCATTTCCGTAGAAGTAGGCGGTGTCTATGTGCCGGTAGCCCACATCAATCGCGTGGAGAACTGCCCGTTCGCAATCGCCTTCCGTCGACTGAAATCACAAGTCATCAATAACGTTAGCGGTTCTTCAAATGACGTTAACCCGGC GGCGACATTCCTGATCCGTATCGGATATGCTATGATCAACCAGTCAATGTCATACCGCGAAGGTGCCCAGTCCGATTCCCTGGATATGGGTTCCGTCGTTGTGCTTGAAGTAGTACTCCACTTTCCCGGTCATCTTCGCGGTTACAAAGTTGAACACTGAATGCTTGGGTTGCTCGCTTCACCTCTGTTATAAGGTTTTCGAATGGGCCCATAGAACCTTCAAAAGACCTTTTGCATTTGCAGATAAAACACGGCCAAGCTGGCAGAGAAACTTGGAAATAGTTTATAGAGACGCAAGGAGCGTAGGTTCTAAGTGTGCTAACCAATATATTAAATGCATTATTTTAATGTTTTAATAAGGATAAATTAAACACATATTTTTTATAAATGATCCAAACCAAATCATGTGTAAAATCCCATTTAAAAATATGTGGGAACACTTTTGAAAAACACTTATCGATAGCTTGATAGTTGAGTGGCGCGCAAAGCTGATTCGGTTA


Search Again